Alt-R A.s. Cas12a (Cpf1) V3 | SCGE Toolkit

SCGE Consortium Home | About SCGE Toolkit | Contact Us | Citing the Toolkit | License

Summary Related Guides Projects & Experiments

SCGE ID	11000000156
Symbol	Alt-R A.s. Cas12a (Cpf1) V3
Description	Recombinant Acidaminococcus sp. BV3L6 (A.s.) nuclease, purified from an E. coli strain expressing Cas12a. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas12a nuclease = 633 pmol.
Species	Acidaminococcus sp. BV3L6
Type	Cas
Subtype	Cas12a (Cpf1) V3

Activity	double strand cleavage
Substrate	double stranded DNA
PAM	5' TTTV

Source	IDT

AACAGGGAGTCTGACAGGGAG

This Genome Editor: Alt-R A.s. Cas12a (Cpf1) V3 is being used ...

Project	Initiative	Contact PI
The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) Experiments Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts	Animal Reporter and Testing Center Initiative	Stephen A Murray, PhD (Jackson Laboratory)