88 results for ai9
88 results for ai9
Ai9 mouseModel System - [In Vivo] [Delivery Systems, AAV tropism, Animal Reporter and Testing Center] [Mouse]Show Experiments (11)
|
Ai9 mouse (BCM)Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
Ai9 SaCas9 Guide AGuide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
HEK-293T with Ai9 transient reporter assayModel System - [In Vitro] [Delivery Systems] [Human]Show Experiments (1) |
Ai9-SauSpyCas9 mouseModel System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
Ai9 SaCas9 Guide BGuide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
Ai9 mouse immortalized fibroblastsModel System - [In Vitro] [Delivery Systems] [Mouse] |
Cre Recombinase dose escalation study in Ai9 miceExperiment - [In Vivo] [Delivery Systems] [Mouse] |
FUS (focused ultrasound) array validation in Ai9 miceExperiment - [In Vivo] [Delivery Systems] [Mouse] |
Testing gRNA sequence and gRNA scaffold modified in Ai9 mice.Experiment - [In Vivo] [Delivery Systems] [Mouse] |
Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitroExperiment - [In Vitro] [Delivery Systems] [Mouse] |
[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 miceExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse] |
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse] |
Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse] |
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.Experiment - [In Vivo] [Delivery Systems] [Mouse] |
Ai9LR21-SaCas9Vector - [In Vivo] [Delivery Systems] [Mouse]Show Experiments (1) |
Sa_Ai9_RGuide - [In Vivo] [Delivery Systems] [Mouse]Show Experiments (1) |
RNP-NC-no ligandDelivery System - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects, Animal Reporter and Testing Center] [Mouse]Show Experiments (4)
|
RNP-NC-RVGDelivery System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
Ai14 gRNAGuide - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]Show Experiments (3)
|
Other Id:
ab150155
AB_2813835
Abcam, Donkey anti-rat alexa fluour 647 |
Other Id:
RRID:AB_2209751
|
SaCas9Genome Editor - [In Vivo] [Delivery Systems] [Mouse]Show Experiments (1) |
AAV+Focused UltrasoundDelivery System - [In Vivo] [Delivery Systems] [Mouse]Show Experiments (1) |
Sa_Ai9_LGuide - [In Vivo] [Delivery Systems] [Mouse]Show Experiments (1) |
Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.Experiment - [In Vivo] [Delivery Systems] [Mouse] |
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
Murray-SATC_Gong-Validation Brain Injection in Mice ProtocolProtocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
Other Id:
RRID:AB_141637
|
Other Id:
Rockland Cat# 600-401-379
AB_2209751
Anti-RFP (RABBIT) Antibody |
Other Id:
AB_2532994
13-0300Â
Thermo-Fisher, Rat anti-GFAP |
Other Id:
AB_141607
A21202
Invitrogen, Donkey anti-mouse alexafluor 488 |
Other Id:
RRID:AB_2532994
|
AAVcc47-SaCas9-Ai9Vector - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
sNLS-SpCas9-sNLSGenome Editor - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects, Animal Reporter and Testing Center] [Mouse]Show Experiments (6)
|
Ai14 mouseModel System - [In Vivo] [Delivery Systems] [Mouse] |
Other Id:
AB_10711040
ab104224Â
Abcam, mouse anti-NeuN |
Other Id:
RRID:AB_2813835
|
Other Id:
RRID:AB_141607
|
g-loxP2_C9Guide - [In Vivo] [Delivery Systems] [Mouse] |
L2-modifiedGuide - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] |
R2-unmodifiedGuide - [In Vitro] [Delivery Systems] [Mouse] |
sgAi9LGuide - [In Vivo, In Vitro] [Delivery Systems] [Human, Mouse] |
Ai14 mouse (congenic)Model System - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]Show Experiments (7)
|
BCM_ssAAV5-Sp_sgAGuide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
L3-modifedGuide - [In Vitro] [Delivery Systems] [Mouse] |
g-loxPbot_C12aGuide - [In Vivo] [Delivery Systems] [Mouse] |
sg298Guide - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] [Mouse]Show Experiments (3) |
SaLoxP2-modifiedGuide - [In Vitro] [Delivery Systems] [Mouse] |
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
RNP-NC-CPPDelivery System - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects, Animal Reporter and Testing Center] [Mouse]Show Experiments (6)
|
Gong_Intracranial Injection Procedure for MiceProtocol - [In Vivo] [Delivery Systems] [Mouse] |
Murray-SATC_Gong-Validaiton_Gong Study ProtocolProtocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
Other Id:
AB_141637
A21207
Invitrogen, Donkey anti-rabbit alexa fluor 594 |
Other Id:
RRID:AB_10711040
|
AAVcc47-Ai9-sgRNA2-CB-SaCas9Vector - [In Vivo] [Delivery Systems] [Mouse] |
BCM_ssAAV5-Sa_sgBGuide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
BCM_ssAAV5-Sp_sgBGuide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
L1-unmodifiedGuide - [In Vitro] [Delivery Systems] [Mouse] |
L2-unmodifiedGuide - [In Vitro] [Delivery Systems] [Mouse] |
L3-unmodifiedGuide - [In Vitro] [Delivery Systems] [Mouse] |
R1-modifiedGuide - [In Vitro] [Delivery Systems] [Mouse] |
sgAi9RGuide - [In Vivo, In Vitro] [Delivery Systems] [Human, Mouse] |
[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
SauCas9Genome Editor - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
AAVcc47-Ai9-sgRNA1-CB-SaCas9Vector - [In Vivo] [Delivery Systems] [Mouse] |
Testing AAV5 for activation of tdTomato in mouse airwayExperiment - [In Vivo] [Delivery Systems] [Mouse] |
L1-modifiedGuide - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]Show Experiments (3) |
R1-unmodifiedGuide - [In Vitro] [Delivery Systems] [Mouse] |
R2-modifiedGuide - [In Vivo, In Vitro] [Delivery Systems] [Mouse] |
SaLoxP1-modifiedGuide - [In Vitro] [Delivery Systems] [Mouse] |
SaLoxP1-unmodifiedGuide - [In Vitro] [Delivery Systems] [Mouse] |
AAVcc47_pTR_self comp 2xU6-Ai9 guidesVector - [In Vivo] [Delivery Systems] [Mouse] |
SaLoxP2-unmodifiedGuide - [In Vitro] [Delivery Systems] [Mouse] |
AAV9-Ai9-sgRNA1-CB-SaCas9Vector - [In Vivo] [Delivery Systems] [Mouse] |
AAV9_pTR_self comp 2xU6-Ai9 guidesVector - [In Vivo] [Delivery Systems] [Mouse] |
Podocyte-specific gene editing in human kidney organoidsExperiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] |
AAV Tropism projectExperiment - [In Vivo] [AAV tropism] [Mouse] |
AAVcc47-Ai9-sgRNA1 + sgRNA2Vector - [In Vivo] [Delivery Systems] [Mouse] |
AAV9-Ai9-sgRNA2-CB-SaCas9Vector - [In Vivo] [Delivery Systems] [Mouse] |
Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cellsExperiment - [In Vivo] [Delivery Systems] [Mouse] |
AAV9-Ai9-sgRNA1 + sgRNA2Vector - [In Vivo] [Delivery Systems] [Mouse] |
Testing AAV5 for activation of tdTomato in HEK293T cellsExperiment - [In Vitro] [Delivery Systems] [Human] |
Heaney_SATC Tissue Processing, Imaging and AnalysisProtocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse]Show Experiments (4)
|
[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
sg298Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse]Show Experiments (4)
|
88 results for ai9
Category | Name | Description | Source | View Associated... |
---|---|---|---|---|
Model System | Ai9 mouse | Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. | The Jackson Laboratory |
Show Experiments (11)
|
Model System | Ai9 mouse (BCM) | Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. | Baylor College of Medicine | |
Guide | Ai9 SaCas9 Guide A | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
Model System | HEK-293T with Ai9 transient reporter assay | HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. |
Show Experiments (1) |
|
Model System | Ai9-SauSpyCas9 mouse | Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. | Baylor College of Medicine | |
Guide | Ai9 SaCas9 Guide B | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
Model System | Ai9 mouse immortalized fibroblasts | Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice | ||
Experiment | Cre Recombinase dose escalation study in Ai9 mice | A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images. | ||
Experiment | FUS (focused ultrasound) array validation in Ai9 mice | 9.3 week-old Ai9 mice (4 male and 4 female) were administered Ai9-targeting SaCas9 AAV9 vector through intravenous adminsitration (2E12 vg/mouse) and left hemisphere was targeted by FUS (focused ultrasound) array for BBB (blood brain barrier) opening | ||
Experiment | Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. | 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later. | ||
Experiment | Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro | Reporter transgene activation by SaCas9 gRNA target and modified scaffold sequences by transient transfection in immortalized Ai9 mouse fibroblasts | ||
Experiment | [Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice | AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway | ||
Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) | A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) | A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
Experiment | Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) | A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. | A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
Vector | Ai9LR21-SaCas9 | AAV9 encoding S. aureus Cas9 and two guide RNAs with modified scaffolds | Leong Lab |
Show Experiments (1) |
Guide | Sa_Ai9_R | This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) |
Show Experiments (1) |
|
Delivery System | RNP-NC-no ligand | The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. | Gong Lab |
Show Experiments (4)
|
Delivery System | RNP-NC-RVG | The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry | Gong Lab | |
Guide | Ai14 gRNA | This sgRNA targets the Ai9 and related transgenes at multiple sites | IDT |
Show Experiments (3)
|
Antibody | AB_2813835 | Abcam, Donkey anti-rat alexa fluour 647 | ||
Antibody | RRID:AB_2209751 | |||
Genome Editor | SaCas9 | Leong Lab |
Show Experiments (1) |
|
Delivery System | AAV+Focused Ultrasound | See vector details | Leong Lab |
Show Experiments (1) |
Guide | Sa_Ai9_L | This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) |
Show Experiments (1) |
|
Experiment | Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. | Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression. | ||
Experiment | [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain | Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice | ||
Protocol | Murray-SATC_Gong-Validation Brain Injection in Mice Protocol | Procedure for brain injection surgical procedure, pre- and post-operative care for mice. | ||
Antibody | RRID:AB_141637 | |||
Antibody | AB_2209751 | Anti-RFP (RABBIT) Antibody | ||
Antibody | AB_2532994 | Thermo-Fisher, Rat anti-GFAP | ||
Antibody | AB_141607 | Invitrogen, Donkey anti-mouse alexafluor 488 | ||
Antibody | RRID:AB_2532994 | |||
Vector | AAVcc47-SaCas9-Ai9 | AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter | Asokan Lab | |
Genome Editor | sNLS-SpCas9-sNLS | SpCas9 with N- and C-terminal SV40 NLS | Aldevron 9212-5MG |
Show Experiments (6)
|
Model System | Ai14 mouse | Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. | The Jackson Laboratory | |
Antibody | AB_10711040 | Abcam, mouse anti-NeuN | ||
Antibody | RRID:AB_2813835 | |||
Antibody | RRID:AB_141607 | |||
Guide | g-loxP2_C9 | This sgRNA targets the Ai9 and related transgenes | IDT | |
Guide | L2-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
Guide | R2-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
Guide | sgAi9L | This sgRNA targets the Ai9 and related transgenes | IDT | |
Model System | Ai14 mouse (congenic) | Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. | The Jackson Laboratory |
Show Experiments (7)
|
Guide | BCM_ssAAV5-Sp_sgA | This sgRNA targets the Ai9 and related transgenes | Vector encoded | |
Guide | L3-modifed | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
Guide | g-loxPbot_C12a | This sgRNA targets the Ai9 and related transgenes at two sites | IDT | |
Guide | sg298 | This sgRNA targets the Ai9 and related transgenes at multiple sites | Synthego |
Show Experiments (3) |
Guide | SaLoxP2-modified | This gRNA targets the mTmG, Ai9 and related transgenes at two sites | Vector encoded | |
Experiment | [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain | Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed. | ||
Delivery System | RNP-NC-CPP | The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity | Gong Lab |
Show Experiments (6)
|
Protocol | Gong_Intracranial Injection Procedure for Mice | Procedure for intracranial delivery to mouse brain. | ||
Protocol | Murray-SATC_Gong-Validaiton_Gong Study Protocol | Procedure for intracranial injection, immunofluorescence and imaging. | ||
Antibody | AB_141637 | Invitrogen, Donkey anti-rabbit alexa fluor 594 | ||
Antibody | RRID:AB_10711040 | |||
Vector | AAVcc47-Ai9-sgRNA2-CB-SaCas9 | AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
Guide | BCM_ssAAV5-Sa_sgB | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
Guide | BCM_ssAAV5-Sp_sgB | This sgRNA targets the Ai9 and related transgenes | Vector encoded | |
Guide | L1-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
Guide | L2-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
Guide | L3-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
Guide | R1-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
Guide | sgAi9R | This sgRNA targets the Ai9 and related transgenes | IDT | |
Experiment | [Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. | Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues. | ||
Genome Editor | SauCas9 | |||
Vector | AAVcc47-Ai9-sgRNA1-CB-SaCas9 | AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
Experiment | Testing AAV5 for activation of tdTomato in mouse airway | AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation | ||
Guide | L1-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded |
Show Experiments (3) |
Guide | R1-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
Guide | R2-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
Guide | sgAi9L | This sgRNA targets the Ai9 and related transgenes | ||
Guide | SaLoxP1-modified | This gRNA targets the mTmG, Ai9 and related transgenes at two sites | Vector encoded | |
Guide | SaLoxP1-unmodified | This gRNA targets the mTmG, Ai9 and related transgenes at two sites | Vector encoded | |
Vector | AAVcc47_pTR_self comp 2xU6-Ai9 guides | AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene | Asokan Lab | |
Guide | SaLoxP2-unmodified | This gRNA targets the mTmG, Ai9 and related transgenes at two sites | Vector encoded | |
Vector | AAV9-Ai9-sgRNA1-CB-SaCas9 | AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
Vector | AAV9_pTR_self comp 2xU6-Ai9 guides | AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene | Asokan Lab | |
Experiment | Podocyte-specific gene editing in human kidney organoids | Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter. | ||
Experiment | AAV Tropism project | Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging | ||
Vector | AAVcc47-Ai9-sgRNA1 + sgRNA2 | AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus | Asokan Lab | |
Vector | AAV9-Ai9-sgRNA2-CB-SaCas9 | AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
Experiment | Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells | AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types. | ||
Vector | AAV9-Ai9-sgRNA1 + sgRNA2 | AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus | Asokan Lab | |
Experiment | Testing AAV5 for activation of tdTomato in HEK293T cells | AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence. | ||
Protocol | Heaney_SATC Tissue Processing, Imaging and Analysis | Procedure for tissue preparation, imaging and analysis. |
Show Experiments (4)
|
|
Experiment | [Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain | Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice | ||
Guide | sg298 | This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases | Synthego |
Show Experiments (4)
|