Search Result for ai9 | SCGE Toolkit

Table View
List View

94 results for ai9

Ai9 mouse Model System - [In Vivo] [Mouse] Matched Fields: name : Ai9 mouse description : Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent guide : Sa_Ai9_L Sa_Ai9_R Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Ai9 mouse immortalized fibroblasts Model System - [In Vitro] [Mouse] Matched Fields: name : Ai9 mouse immortalized fibroblasts description : Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Ai9 mouse (BCM) Model System - [In Vivo] [Mouse] Matched Fields: name : Ai9 mouse (BCM) description : Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Ai9 SaCas9 Guide A Guide - [In Vivo] [Mouse] Matched Fields: name : Ai9 SaCas9 Guide A description : This gRNA targets the Ai9 and related transgenes guide : Ai9 SaCas9 Guide A This gRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Ai9-SauSpyCas9 mouse Model System - [In Vivo] [Mouse] Matched Fields: name : Ai9-SauSpyCas9 mouse description : Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9 Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Ai9 SaCas9 Guide B Guide - [In Vivo] [Mouse] Matched Fields: name : Ai9 SaCas9 Guide B description : This gRNA targets the Ai9 and related transgenes guide : Ai9 SaCas9 Guide B This gRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
HEK-293T with Ai9 transient reporter assay Model System - [In Vitro] [Human] Matched Fields: name : HEK-293T with Ai9 transient reporter assay description : HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
FUS (focused ultrasound) array validation in Ai9 mice Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: name : FUS (focused ultrasound) array validation in Ai9 mice description : 9.3 week-old Ai9 mice (4 male and 4 female) were administered Ai9-targeting SaCas9 AAV9 vector through guide : Sa_Ai9_L Sa_Ai9_R Leong Kam W Last Updated Date: 2022-04-15 9.3 week-old Ai9 mice (4 male and 4 female) were administered Ai9-targeting SaCas9 AAV9 vector through intravenous adminsitration (2E12 vg/mouse) and left hemisphere was targeted by FUS (focused ultrasound) array for BBB (blood brain barrier) opening Show Project Focused Ultrasound-mediated Delivery of Gene-editing Elements to the Brain for Neurodegenerative Disorders
Cre Recombinase dose escalation study in Ai9 mice Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: name : Cre Recombinase dose escalation study in Ai9 mice description : A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 Asokan Aravind Last Updated Date: 2021-09-16 A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: name : Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. description : /mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 Deverman Benjamin E Last Updated Date: 2021-04-17 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later. Show Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System
Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Experiment - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: name : Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus description : activation by SaCas9 gRNA target and modified scaffold sequences by transient transfection in immortalized Ai9 Deverman Benjamin E Last Updated Date: 2021-04-17 Reporter transgene activation by SaCas9 gRNA target and modified scaffold sequences by transient transfection in immortalized Ai9 mouse fibroblasts Show Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System
[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: name : Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 Heaney Jason D Last Updated Date: 2021-03-30 AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Gao Validation (Gao, Guang-Ping )
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to description : This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 description : This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to description : This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to description : This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Ai9LR21-SaCas9 Vector - [In Vivo] [Mouse] Matched Fields: symbol : Ai9LR21-SaCas9 guide : Sa_Ai9_L Sa_Ai9_R AAV9 encoding S. aureus Cas9 and two guide RNAs with modified scaffolds Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: guide : Ai14 gRNA Gong Shaoqin (Sarah) Last Updated Date: 2020-10-28 Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression. Show Project Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
AB_10711040 Antibody - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Other Id: Ab104224 Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 Abcam, mouse anti-NeuN Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
AB_141607 Antibody - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Other Id: Ab104224 Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 Invitrogen, Donkey anti-mouse alexafluor 488 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Ai14 gRNA Guide - [In Vivo] [Mouse] Matched Fields: description : This sgRNA targets the Ai9 and related transgenes at multiple sites guide : Ai14 gRNA This sgRNA targets the Ai9 and related transgenes at multiple sites Show Experiments (3) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_2532994 Antibody - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
23. Focused ultrasound-mediated brain genome editing. Publication - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: guide : Sa_Ai9_L Sa_Ai9_R Lao YH, Ji R, Zhou JK, Snow KJ, Kwon N, Saville E, He S, Chauhan S, Chi CW, Datta MS, Zhang H, Quek CH, Cai SS, Li M, Gaitan Y, Bechtel L, Wu SY, Lutz CM, Tomer R, Murray SA, Chavez A, Konofagou EE, Leong KW PUBMED: 37579143, PMC PMC10450663, DOI 10.1073/pnas.2302910120 ABSTRACT: Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to ... SCGE data tags... Projects Focused Ultrasound-mediated Delivery of Gene-editing Elements to the Brain for Neurodegenerative Disorders
AAV+Focused Ultrasound Delivery System - [In Vivo] [Mouse] Matched Fields: guide : Sa_Ai9_L Sa_Ai9_R See vector details Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
SaCas9 Genome Editor - [In Vivo] [Mouse] Matched Fields: guide : Sa_Ai9_L Sa_Ai9_R Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
AB_2209751 Antibody - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Other Id: Ab104224 Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 Anti-RFP (RABBIT) Antibody Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Murray-SATC_Gong-Validation Brain Injection in Mice Protocol Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: guide : Ai14 gRNA Procedure for brain injection surgical procedure, pre- and post-operative care for mice. Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_2209751 Antibody - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_10711040 Antibody - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RNP-NC-RVG Delivery System - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry Show Experiments (2) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
AB_141637 Antibody - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Other Id: Ab104224 Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 Invitrogen, Donkey anti-rabbit alexa fluor 594 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Ai14 mouse Model System - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Murray-SATC_Gong-Validaiton_Gong Study Protocol Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: guide : Ai14 gRNA Procedure for intracranial injection, immunofluorescence and imaging. Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_141637 Antibody - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_2813835 Antibody - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
g-loxP2_C9 Guide - [In Vivo] [Mouse] Matched Fields: description : This sgRNA targets the Ai9 and related transgenes This sgRNA targets the Ai9 and related transgenes Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
L1-modified Guide - [In Vivo, In Vitro] [Mouse] Matched Fields: description : This gRNA targets the Ai9 and related transgenes This gRNA targets the Ai9 and related transgenes Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
38. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. Publication - [In Vivo] [Delivery Systems, Collaborative Opportunity Fund, Animal Reporter and Testing Center] [Mouse] Matched Fields: guide : Ai14 gRNA Madisen L, Zwingman TA, Sunkin SM, Oh SW, Zariwala HA, Gu H, Ng LL, Palmiter RD, Hawrylycz MJ, Jones AR, Lein ES, Zeng H PII: nn.2467, PUBMED 20023653, PMC PMC2840225, MID NIHMS165655, DOI 10.1038/nn.2467 ABSTRACT: The Cre/lox system is widely used in mice to achieve cell-type-specific gene expression. However, a strong and universally responding system to express genes under Cre control is still lacking. We have generated a set of Cre reporter mice with strong, ubiquitous expression of fluorescent proteins of different spectra. The robust native fluorescence of these reporters enables direct visualization of fine dendritic structures and axonal projections of the labeled neurons, which is useful in mappin ... SCGE data tags... Organisms: Mouse; Models: Ai14 mouse (congenic); Projects Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi) The Jackson Laboratory Gene Editing Testing Center - Gong Validation (Gong, Shaoqin) The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data) The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Gong, Submission 2 (On- and Off-target data)
Sa_Ai9_R Guide - [In Vivo] [Mouse] Matched Fields: description : This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) guide : Sa_Ai9_R This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Gong_Intracranial Injection Procedure for Mice Protocol - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: guide : Ai14 gRNA Procedure for intracranial delivery to mouse brain. Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
AB_2813835 Antibody - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Other Id: Ab104224 Rockland Cat# 600-401-379 A21202 A21207 Ab150155 13-0300 Abcam, Donkey anti-rat alexa fluour 647 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
sNLS-SpCas9-sNLS Genome Editor - [In Vivo, In Vitro] [Mouse] Matched Fields: guide : Ai14 gRNA SpCas9 with N- and C-terminal SV40 NLS Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
RRID:AB_141607 Antibody - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: guide : Ai14 gRNA Murray Stephen A Last Updated Date: 2023-05-10 Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice Show Project The Jackson Laboratory Gene Editing Testing Center - Gong Validation (Gong, Shaoqin)
L2-modified Guide - [In Vivo, In Vitro] [Mouse] Matched Fields: description : This gRNA targets the Ai9 and related transgenes This gRNA targets the Ai9 and related transgenes Show Experiments (2) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
L3-modifed Guide - [In Vitro] [Mouse] Matched Fields: description : This gRNA targets the Ai9 and related transgenes This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
R2-modified Guide - [In Vivo, In Vitro] [Mouse] Matched Fields: description : This gRNA targets the Ai9 and related transgenes This gRNA targets the Ai9 and related transgenes Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
SauCas9 Genome Editor - [In Vivo] [Mouse] Matched Fields: guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
AAVcc47-Cre Vector - [In Vivo] [Mouse] Matched Fields: guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B AAV2/5 expressing Cre recombinase Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
g-loxPbot_C12a Guide - [In Vivo] [Mouse] Matched Fields: description : This sgRNA targets the Ai9 and related transgenes at two sites This sgRNA targets the Ai9 and related transgenes at two sites Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
L1-unmodified Guide - [In Vitro] [Mouse] Matched Fields: description : This gRNA targets the Ai9 and related transgenes This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
L3-unmodified Guide - [In Vitro] [Mouse] Matched Fields: description : This gRNA targets the Ai9 and related transgenes This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
R1-modified Guide - [In Vitro] [Mouse] Matched Fields: description : This gRNA targets the Ai9 and related transgenes This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
R2-unmodified Guide - [In Vitro] [Mouse] Matched Fields: description : This gRNA targets the Ai9 and related transgenes This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
sgAi9R Guide - [In Vivo, In Vitro] [Human, Mouse] Matched Fields: description : This sgRNA targets the Ai9 and related transgenes This sgRNA targets the Ai9 and related transgenes Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
BCM_ssAAV5-Sp_sgA Guide - [In Vivo] [Mouse] Matched Fields: description : This sgRNA targets the Ai9 and related transgenes This sgRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
L2-unmodified Guide - [In Vitro] [Mouse] Matched Fields: description : This gRNA targets the Ai9 and related transgenes This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
sgAi9L Guide - [In Vivo, In Vitro] [Human, Mouse] Matched Fields: description : This sgRNA targets the Ai9 and related transgenes This sgRNA targets the Ai9 and related transgenes Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: guide : Ai14 gRNA Murray Stephen A Last Updated Date: 2023-07-18 Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed. Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Gong, Submission 2 (On- and Off-target data)
AB_2532994 Antibody - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Other Id: Ab104224 Rockland Cat# 600-401-379 A21202 A21207 Ab150155 13-0300 Thermo-Fisher, Rat anti-GFAP Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RNP-NC-CPP Delivery System - [In Vivo, In Vitro] [Mouse] Matched Fields: guide : Ai14 gRNA The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
RNP-NC-no ligand Delivery System - [In Vivo, In Vitro] [Mouse] Matched Fields: guide : Ai14 gRNA The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. Show Experiments (4) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
BCM_ssAAV5-Sa_sgB Guide - [In Vivo] [Mouse] Matched Fields: description : This gRNA targets the Ai9 and related transgenes This gRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
BCM_ssAAV5-Sp_sgB Guide - [In Vivo] [Mouse] Matched Fields: description : This sgRNA targets the Ai9 and related transgenes This sgRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
R1-unmodified Guide - [In Vitro] [Mouse] Matched Fields: description : This gRNA targets the Ai9 and related transgenes This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
sgAi9L Guide Matched Fields: description : This sgRNA targets the Ai9 and related transgenes This sgRNA targets the Ai9 and related transgenes
SaLoxP1-modified Guide - [In Vitro] [Mouse] Matched Fields: description : This gRNA targets the mTmG, Ai9 and related transgenes at two sites This gRNA targets the mTmG, Ai9 and related transgenes at two sites Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
SaLoxP2-modified Guide - [In Vitro] [Mouse] Matched Fields: description : This gRNA targets the mTmG, Ai9 and related transgenes at two sites This gRNA targets the mTmG, Ai9 and related transgenes at two sites Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Sa_Ai9_L Guide - [In Vivo] [Mouse] Matched Fields: description : This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) guide : Sa_Ai9_L This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B Heaney Jason D Last Updated Date: 2021-03-30 Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues. Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Asokan Validation (Asokan, Aravind)
AAVcc47-SaCas9-Ai9 Vector - [In Vivo] [Mouse] Matched Fields: guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Ai14 mouse (congenic) Model System - [In Vivo] [Mouse] Matched Fields: guide : Ai14 gRNA Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
73. Canalostomy As a Surgical Approach to Local Drug Delivery into the Inner Ears of Adult and Neonatal Mice. Publication - [In Vivo] [Delivery Systems, Collaborative Opportunity Fund, Animal Reporter and Testing Center] [Mouse] Matched Fields: guide : Ai14 gRNA Guo JY, He L, Qu TF, Liu YY, Liu K, Wang GP, Gong SS PUBMED: 29889202, PMC PMC6101422, DOI 10.3791/57351 ABSTRACT: Local delivery of therapeutic drugs into the inner ear is a promising therapy for inner ear diseases. Injection through semicircular canals (canalostomy) has been shown to be a useful approach to local drug delivery into the inner ear. The goal of this article is to describe, in detail, the surgical techniques involved in canalostomy in both adult and neonatal mice. As indicated by fast-green dye and adeno-associated virus serotype 8 with the green fluorescent protein gene, the canalostomy facil ... SCGE data tags... Organisms: Mouse; Models: Ai14 mouse (congenic); Projects Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi) The Jackson Laboratory Gene Editing Testing Center - Gong Validation (Gong, Shaoqin) The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data) The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Gong, Submission 2 (On- and Off-target data)
sg298 Guide - [In Vivo, In Vitro] [Mouse] Matched Fields: description : This sgRNA targets the Ai9 and related transgenes at multiple sites This sgRNA targets the Ai9 and related transgenes at multiple sites Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Podocyte-specific gene editing in human kidney organoids
SaLoxP1-unmodified Guide - [In Vitro] [Mouse] Matched Fields: description : This gRNA targets the mTmG, Ai9 and related transgenes at two sites This gRNA targets the mTmG, Ai9 and related transgenes at two sites Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
SaLoxP2-unmodified Guide - [In Vitro] [Mouse] Matched Fields: description : This gRNA targets the mTmG, Ai9 and related transgenes at two sites This gRNA targets the mTmG, Ai9 and related transgenes at two sites Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAV9-Ai9-sgRNA2-CB-SaCas9 Vector - [In Vivo] [Mouse] Matched Fields: description : AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Testing AAV5 for activation of tdTomato in mouse airway Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: description : mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gao Guang-Ping Last Updated Date: 2020-10-20 AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
AAVcc47-Ai9-sgRNA1-CB-SaCas9 Vector - [In Vivo] [Mouse] Matched Fields: description : AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAVcc47-Ai9-sgRNA2-CB-SaCas9 Vector - [In Vivo] [Mouse] Matched Fields: description : AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAVcc47_pTR_self comp 2xU6-Ai9 guides Vector - [In Vivo] [Mouse] Matched Fields: description : AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
AAV9-Ai9-sgRNA1-CB-SaCas9 Vector - [In Vivo] [Mouse] Matched Fields: description : AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAV9-Ai9-sgRNA1 + sgRNA2 Vector - [In Vivo] [Mouse] Matched Fields: description : AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: description : mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gao Guang-Ping Last Updated Date: 2021-09-21 AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types. Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
85. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing. Publication - [In Vivo] [Delivery Systems, DCC, AAV tropism, Animal Reporter and Testing Center] [Mouse] Matched Fields: guide : Sa_Ai9_L Sa_Ai9_R Gonzalez TJ, Simon KE, Blondel LO, Fanous MM, Roger AL, Maysonet MS, Devlin GW, Smith TJ, Oh DK, Havlik LP, Castellanos Rivera RM, Piedrahita JA, ElMallah MK, Gersbach CA, Asokan A PII: 10.1038/s41467-022-33745-4, PUBMED 36210364, PMC PMC9548504, DOI 10.1038/s41467-022-33745-4 ABSTRACT: Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attrib ... SCGE data tags... Organisms: Mouse; Models: Ai9 mouse; Editors SaCas9-Lagor; Vectors AAV9-CMV-Cre; AAVcc47-CMV-Cre; AAV9-Ai9-sgRNA2-CB-SaCas9; AAVcc47-Ai9-sgRNA1-CB-SaCas9; AAVcc47-Ai9-sgRNA2-CB-SaCas9; AAV9-Ai9-sgRNA1-CB-SaCas9; AAV9-CMV-SaCas9; AAVcc47-Ai9-sgRNA1 + sgRNA2; AAVcc47-CMV-SaCas9; AAV9-Ai9-sgRNA1 + sgRNA2; AAVcc47_pTR_self comp 2xU6-Ai9 guides; AAV9_pTR_self comp 2xU6-Ai9 guides; Projects Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Evolving High Potency AAV Vectors for Neuromuscular Genome Editing Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Deverman Validation (Deverman, Benjamin) Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Evolving High Potency AAV Vectors for Neuromuscular Genome Editing Focused Ultrasound-mediated Delivery of Gene-editing Elements to the Brain for Neurodegenerative Disorders SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice
AAVcc47-Ai9-sgRNA1 + sgRNA2 Vector - [In Vivo] [Mouse] Matched Fields: description : AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Heaney_SATC Tissue Processing, Imaging and Analysis Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B Procedure for tissue preparation, imaging and analysis. Show Experiments (4) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
AAV9_pTR_self comp 2xU6-Ai9 guides Vector - [In Vivo] [Mouse] Matched Fields: description : AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Podocyte-specific gene editing in human kidney organoids Experiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] Matched Fields: description : Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter Genome editing events were detected by induction of tdTomato from the Ai9 reporter. Wilson Ross C. , Freedman Benjamin S Last Updated Date: 2024-01-16 Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter. Show Project Cas9 ribonucleoprotein delivery targeted to kidney epithelium
AAV Tropism project Experiment - [In Vivo] [AAV tropism] [Mouse] Matched Fields: description : Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized Lutz Cathleen M , Gao Guang-Ping , Heaney Jason D , Murray Stephen A , Lagor William Raymond , Dickinson Mary E Last Updated Date: 2023-02-10 Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging Show Project SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice
Testing AAV5 for activation of tdTomato in HEK293T cells Experiment - [In Vitro] [Delivery Systems] [Human] Matched Fields: description : AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T Gao Guang-Ping Last Updated Date: 2020-10-20 AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence. Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: description : Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 Heaney Jason D Last Updated Date: 2023-05-10 Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Deverman Validation (Deverman, Benjamin)
sg298 Guide - [In Vivo] [Mouse] Matched Fields: description : This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Cre recombinase Genome Editor - [In Vivo, In Vitro] [Mouse] Matched Fields: guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B Cre recombinase delivered by AAV (see vector details) Show Experiments (4) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Cre Recombinase dose escalation study in Ai9 mice Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

94 results for ai9

Category	Name	Description	Source	View Associated...
Model System	Ai9 mouse	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	The Jackson Laboratory	Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Model System	Ai9 mouse immortalized fibroblasts	Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice		Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Model System	Ai9 mouse (BCM)	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	Baylor College of Medicine	Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Guide	Ai9 SaCas9 Guide A	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Model System	Ai9-SauSpyCas9 mouse	Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.	Baylor College of Medicine	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Guide	Ai9 SaCas9 Guide B	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Model System	HEK-293T with Ai9 transient reporter assay	HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.		Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Experiment	FUS (focused ultrasound) array validation in Ai9 mice	9.3 week-old Ai9 mice (4 male and 4 female) were administered Ai9-targeting SaCas9 AAV9 vector through intravenous adminsitration (2E12 vg/mouse) and left hemisphere was targeted by FUS (focused ultrasound) array for BBB (blood brain barrier) opening		Show Project Focused Ultrasound-mediated Delivery of Gene-editing Elements to the Brain for Neurodegenerative Disorders
Experiment	Cre Recombinase dose escalation study in Ai9 mice	A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Experiment	Testing gRNA sequence and gRNA scaffold modified in Ai9 mice.	3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later.		Show Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System
Experiment	Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro	Reporter transgene activation by SaCas9 gRNA target and modified scaffold sequences by transient transfection in immortalized Ai9 mouse fibroblasts		Show Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System
Experiment	[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice	AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Gao Validation (Gao, Guang-Ping )
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)	A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Experiment	Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)	A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)	A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.	A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Vector	Ai9LR21-SaCas9	AAV9 encoding S. aureus Cas9 and two guide RNAs with modified scaffolds	Leong Lab	Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Experiment	Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.	Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression.		Show Project Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
Antibody	AB_10711040	Abcam, mouse anti-NeuN		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	AB_141607	Invitrogen, Donkey anti-mouse alexafluor 488		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Guide	Ai14 gRNA	This sgRNA targets the Ai9 and related transgenes at multiple sites	IDT	Show Experiments (3) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_2532994			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Publication	Focused ultrasound-mediated brain genome editing.	Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to the brain.
Delivery System	AAV+Focused Ultrasound	See vector details	Leong Lab	Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Genome Editor	SaCas9		Leong Lab	Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Antibody	AB_2209751	Anti-RFP (RABBIT) Antibody		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Protocol	Murray-SATC_Gong-Validation Brain Injection in Mice Protocol	Procedure for brain injection surgical procedure, pre- and post-operative care for mice.		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_2209751			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_10711040			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Delivery System	RNP-NC-RVG	The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry	Gong Lab	Show Experiments (2) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	AB_141637	Invitrogen, Donkey anti-rabbit alexa fluor 594		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Model System	Ai14 mouse	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Protocol	Murray-SATC_Gong-Validaiton_Gong Study Protocol	Procedure for intracranial injection, immunofluorescence and imaging.		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_141637			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_2813835			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Guide	g-loxP2_C9	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Guide	L1-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Publication	A robust and high-throughput Cre reporting and characterization system for the whole mouse brain.	The Cre/lox system is widely used in mice to achieve cell-type-specific gene expression. However, a strong and universally responding system to express genes under Cre control is still lacking. We have generated a set of Cre reporter mice with strong, ubiquitous expression of fluorescent proteins of different spectra. The robust native fluorescence of these reporters enables direct visualization of fine dendritic structures and axonal projections of the labeled neurons, which is useful in mapping neuronal circuitry, imaging and tracking specific cell populations in vivo. Using these reporters and a high-throughput in situ hybridization platform, we are systematically profiling Cre-directed gene expression throughout the mouse brain in several Cre-driver lines, including new Cre lines targeting different cell types in the cortex. Our expression data are displayed in a public online database to help researchers assess the utility of various Cre-driver lines for cell-type-specific genetic manipulation.
Guide	Sa_Ai9_R	This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016)		Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Protocol	Gong_Intracranial Injection Procedure for Mice	Procedure for intracranial delivery to mouse brain.		Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Antibody	AB_2813835	Abcam, Donkey anti-rat alexa fluour 647		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Genome Editor	sNLS-SpCas9-sNLS	SpCas9 with N- and C-terminal SV40 NLS	Aldevron 9212-5MG	Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Antibody	RRID:AB_141607			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Experiment	[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain	Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice		Show Project The Jackson Laboratory Gene Editing Testing Center - Gong Validation (Gong, Shaoqin)
Guide	L2-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (2) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Guide	L3-modifed	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	R2-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Genome Editor	SauCas9			Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Vector	AAVcc47-Cre	AAV2/5 expressing Cre recombinase	Asokan Lab	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Guide	g-loxPbot_C12a	This sgRNA targets the Ai9 and related transgenes at two sites	IDT	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Guide	L1-unmodified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	L3-unmodified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	R1-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	R2-unmodified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	sgAi9R	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Guide	BCM_ssAAV5-Sp_sgA	This sgRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Guide	L2-unmodified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	sgAi9L	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Experiment	[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain	Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed.		Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Gong, Submission 2 (On- and Off-target data)
Antibody	AB_2532994	Thermo-Fisher, Rat anti-GFAP		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Delivery System	RNP-NC-CPP	The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity	Gong Lab	Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Delivery System	RNP-NC-no ligand	The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA.	Gong Lab	Show Experiments (4) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Guide	BCM_ssAAV5-Sa_sgB	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Guide	BCM_ssAAV5-Sp_sgB	This sgRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Guide	R1-unmodified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	sgAi9L	This sgRNA targets the Ai9 and related transgenes	IDT
Guide	SaLoxP1-modified	This gRNA targets the mTmG, Ai9 and related transgenes at two sites	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	SaLoxP2-modified	This gRNA targets the mTmG, Ai9 and related transgenes at two sites	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	Sa_Ai9_L	This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016)		Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Experiment	[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.	Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Asokan Validation (Asokan, Aravind)
Vector	AAVcc47-SaCas9-Ai9	AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter	Asokan Lab	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Model System	Ai14 mouse (congenic)	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Publication	Canalostomy As a Surgical Approach to Local Drug Delivery into the Inner Ears of Adult and Neonatal Mice.	Local delivery of therapeutic drugs into the inner ear is a promising therapy for inner ear diseases. Injection through semicircular canals (canalostomy) has been shown to be a useful approach to local drug delivery into the inner ear. The goal of this article is to describe, in detail, the surgical techniques involved in canalostomy in both adult and neonatal mice. As indicated by fast-green dye and adeno-associated virus serotype 8 with the green fluorescent protein gene, the canalostomy facilitated broad distribution of injected reagents in the cochlea and vestibular end-organs with minimal damage to hearing and vestibular function. The surgery was successfully implemented in both adult and neonatal mice; indeed, multiple surgeries could be performed if required. In conclusion, canalostomy is an effective and safe approach to drug delivery into the inner ears of adult and neonatal mice and may be used to treat human inner ear diseases in the future.
Guide	sg298	This sgRNA targets the Ai9 and related transgenes at multiple sites	Synthego	Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Podocyte-specific gene editing in human kidney organoids
Guide	SaLoxP1-unmodified	This gRNA targets the mTmG, Ai9 and related transgenes at two sites	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	SaLoxP2-unmodified	This gRNA targets the mTmG, Ai9 and related transgenes at two sites	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAV9-Ai9-sgRNA2-CB-SaCas9	AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Experiment	Testing AAV5 for activation of tdTomato in mouse airway	AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation		Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Vector	AAVcc47-Ai9-sgRNA1-CB-SaCas9	AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAVcc47-Ai9-sgRNA2-CB-SaCas9	AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAVcc47_pTR_self comp 2xU6-Ai9 guides	AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Vector	AAV9-Ai9-sgRNA1-CB-SaCas9	AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAV9-Ai9-sgRNA1 + sgRNA2	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Experiment	Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells	AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.		Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Publication	Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing.	Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attributes benchmarked against AAV serotype 9 as evidenced by robust reporter and therapeutic gene expression, Cre recombination and CRISPR genome editing in normal and diseased mouse models. Enhanced transduction efficiency of AAV.cc47 vectors is further corroborated in macaques and pigs, providing a strong rationale for potential clinical translation into human gene therapies. We envision that ccAAV vectors may not only improve predictive modeling in preclinical studies, but also clinical translatability by broadening the therapeutic window of AAV based gene therapies.
Vector	AAVcc47-Ai9-sgRNA1 + sgRNA2	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Protocol	Heaney_SATC Tissue Processing, Imaging and Analysis	Procedure for tissue preparation, imaging and analysis.		Show Experiments (4) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Vector	AAV9_pTR_self comp 2xU6-Ai9 guides	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Experiment	Podocyte-specific gene editing in human kidney organoids	Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter.		Show Project Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Experiment	AAV Tropism project	Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging		Show Project SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice
Experiment	Testing AAV5 for activation of tdTomato in HEK293T cells	AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence.		Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Experiment	[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain	Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Deverman Validation (Deverman, Benjamin)
Guide	sg298	This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases	Synthego	Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Genome Editor	Cre recombinase	Cre recombinase delivered by AAV (see vector details)		Show Experiments (4) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Cre Recombinase dose escalation study in Ai9 mice Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

Contact SCGE

94 results for ai9

Select Category

OR Filter By ...

94 results for ai9

[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

AB_10711040

AB_141607

RRID:AB_2532994

23. Focused ultrasound-mediated brain genome editing.

AB_2209751

RRID:AB_2209751

RRID:AB_10711040

AB_141637

RRID:AB_141637

RRID:AB_2813835

38. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain.

AB_2813835

RRID:AB_141607

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

AB_2532994

[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.

73. Canalostomy As a Surgical Approach to Local Drug Delivery into the Inner Ears of Adult and Neonatal Mice.

85. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing.

[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain

94 results for ai9