205 results for aav

AAV

Delivery System  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: guideSource : AAV encoded (see vector details) study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice Evolving High Potency AAV Vectors for Neuromuscular Genome Editing - submission 3 Evolving High Potency AAV Vectors for Neuromuscular Genome Editing name : AAV deliverySystemName : AAV vectorName : AAV2/9CMVeGFP AAV3b-ZsGreen-Cre AAV2-SaCas9 AAV9-CMV-Cre AAV2-gRNA vectorSubtype : AAV vectorAnnotatedMap : Filename: pt366-aav-cmv-nls-sacas9-nls-3xha-bghpa-u6-jcr183_human-dmd.gb
See vector details
Show Experiments (10)

AAV+Focused Ultrasound

Delivery System  - [In Vivo] [Mouse]
Matched Fields: name : AAV+Focused Ultrasound deliverySystemName : AAV+Focused Ultrasound vectorSubtype : AAV
See vector details

AAV Tropism project

Experiment  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice name : AAV Tropism project initiative : AAV tropism deliverySystemName : AAV vectorName : AAV6-ZsGreen-Cre AAV3b-ZsGreen-Cre AAV4-ZsGreen-Cre AAV8-ZsGreen-Cre AAV5-ZsGreen-Cre description : Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized vectorSubtype : AAV
Lutz Cathleen M , Gao Guang-Ping , Heaney Jason D , Murray Stephen A , Lagor William Raymond , Dickinson Mary E  Last Updated Date: 2023-02-10
 
Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging

Conklin_Fast-Seq AAV Protocol

Protocol 
Matched Fields: name : Conklin_Fast-Seq AAV Protocol description : Published procedure for AAV composition measurement using fast-seq. Maynard et al.
Published procedure for AAV composition measurement using fast-seq. Maynard et al. Fast-Seq: A Simple Method for Rapid and Inexpensive Validation of Packaged Single-Stranded Adeno-Associated Viral Genomes in Academic Settings. Hum Gene Ther Methods . 2019 Dec;30(6):195-205. doi: 10.1089/hgtb.2019.110.

Heaney-SATC_Gao-Validation_Intratracheal Delivery of AAV in Mice

Protocol  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: name : Heaney-SATC_Gao-Validation_Intratracheal Delivery of AAV in Mice description : Procedure for Intratracheal (IT) delivery of AAV in mouse lung. vectorSubtype : AAV
Procedure for Intratracheal (IT) delivery of AAV in mouse lung.

SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice

Project  - [In Vivo] [AAV tropism]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice initiative : AAV tropism name : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice
Lutz Cathleen M , Gao Guang-Ping , Heaney Jason D , Murray Stephen A , Lagor William Raymond , Dickinson Mary E  Last Updated Date: 2023-02-10
 
Show Experiments (1)

Evolving High Potency AAV Vectors for Neuromuscular Genome Editing

Project  - [In Vivo] [Delivery Systems]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing - submission 3 Evolving High Potency AAV Vectors for Neuromuscular Genome Editing name : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing description : Recombinant adeno-associated viruses (AAV) have emerged as safe and effective vectors for clinical gene The current proposal is on a comprehensive and innovative approach to evolve high potency AAV variants
Asokan Aravind  Last Updated Date: 2025-10-29 NIH Report
 
Recombinant adeno-associated viruses (AAV) have emerged as safe and effective vectors for clinical gene therapy applications including systemic treatment of neuromuscular diseases such as Spinal Muscular Atrophy (SMA), Duchenne Muscular Dystrophy (DMD), and Giant Axonal Neuropathy (GAN) amongst others. However, genome editing in neuromuscular tissue, in particular, is challenging. The current proposal is on a comprehensive and innovative approach to evolve high potency AAV variants for systemic neuromuscular genome editing.
Show Experiments (9)

AAV tropism in kidney organoids cultured under flow

Experiment  - [In Vitro] [Biological Effects] [Human]
Matched Fields: name : AAV tropism in kidney organoids cultured under flow deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV
Morizane Ryuji  Last Updated Date: 2023-09-22 NIH Report
 
Human kidney organoids generated from human ES and iPS cells are used to evaluate tropism of AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiation day 21 to 28. Four culture conditions were tested: U-well suspension culture, static culture on gelbrin, low flow on a chip coated with gelbrin, and high flow on a chip coated with gelbrin. Immunohistochemistry was performed to visualize transduced cells with staining for podocytes (PODXL) and proximal tubules (LTL). AAV2/2 shows the highest transduction efficiency among three serotypes evaluated, and the GFP expression is highest in the static condition.

AAV tropism in kidney organoids derived from human pluripotent stem cells.

Experiment  - [In Vitro] [Biological Effects] [Human]
Matched Fields: name : AAV tropism in kidney organoids derived from human pluripotent stem cells. deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV
Morizane Ryuji  Last Updated Date: 2023-09-22 NIH Report
 
Human kidney organoids generated from human ES and iPS cells are used to evaluate tropism of AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiaiton day 21 to 28. Immunohistochemistry is performed to visualize transduced cells with staining for podocytes (PODXL), proximal tubules (LTL), loops of Henle and distal nephrons (CDH1), interstitial stromal cells (PDGFRb), and endothelia (CD31). AAV2/2 shows the highest transduction efficiency among three serotypes evaluated, and the GFP expression is highest in proximal tubular cells.

[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: name : Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular vectorName : AAVcc47-Cre AAVcc47-SaCas9-Ai9 description : Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. vectorSubtype : AAV
Heaney Jason D  Last Updated Date: 2021-03-30 NIH Report
 
Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.

11. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing.

Publication  - [In Vivo] [Delivery Systems, DCC, AAV tropism, Animal Reporter and Testing Center] [Mouse]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice Evolving High Potency AAV Vectors for Neuromuscular Genome Editing initiative : AAV tropism deliverySystemName : AAV AAV+Focused Ultrasound name : Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing vectorName : AAVrh8-ZsGreen-Cre AAVcc47-CMV-SaCas9 AAV9-CMV-SaCas9 AAV6-ZsGreen-Cre AAVcc47-mCherry description : Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing Effective clinical translation is confounded, at least in part, by differences in AAV biology across Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques potent, cross-species compatible variant (AAV.cc47) that shows improved attributes benchmarked against AAV modeling in preclinical studies, but also clinical translatability by broadening the therapeutic window of AAV vectorSubtype : AAV capsidSerotype : AAV BI28 (novel engineered variant)
Gonzalez TJ, Simon KE, Blondel LO, Fanous MM, Roger AL, Maysonet MS, Devlin GW, Smith TJ, Oh DK, Havlik LP, Castellanos Rivera RM, Piedrahita JA, ElMallah MK, Gersbach CA, Asokan A
PII: 10.1038/s41467-022-33745-4, PUBMED 36210364, PMC PMC9548504, DOI 10.1038/s41467-022-33745-4

ABSTRACT: Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attrib ...
SCGE data tags...

On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: name : compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV vectorName : AAV-Pcsk9 description : AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice.
Chaikof Elliot L.  Last Updated Date: 2022-04-15 NIH Report
 
On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10.

AAVS1_site_05

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_05 grnaLabId : AAVS1_site_05 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAVS1_site_13

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_13 grnaLabId : AAVS1_site_13 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAVS1_site_14

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_14 grnaLabId : AAVS1_site_14 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAVS1_site_01

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_01 grnaLabId : AAVS1_site_01 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAVS1_site_02

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_02 grnaLabId : AAVS1_site_02 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAVS1_site_06

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_06 grnaLabId : AAVS1_site_06 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAVS1_site_08

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_08 grnaLabId : AAVS1_site_08 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAVS1_site_09

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_09 grnaLabId : AAVS1_site_09 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAVS1_site_11

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_11 grnaLabId : AAVS1_site_11 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAVS1_site_03

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_03 grnaLabId : AAVS1_site_03 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAVS1_site_04

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_04 grnaLabId : AAVS1_site_04 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAVS1_site_07

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_07 grnaLabId : AAVS1_site_07 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAVS1_site_10

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_10 grnaLabId : AAVS1_site_10 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS

Experiment  - [In Vitro] [Biological Effects] [Human]
Matched Fields: name : AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS deliverySystemName : AAV vectorName : AAV2/2CMVeGFP vectorSubtype : AAV
Morizane Ryuji  Last Updated Date: 2023-09-22 NIH Report
 
Human kidney orgnaoids generated from human ES and iPS cells are used to evaluate tropism of AAV2 that expresses eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiation day 22 to 23. Four culture conditions are tested: full flow on a chip, pulsed flow on a chip, no flow on a chip, U-well suspension culture. Flow cytometry is performed to quantify the transduction efficiency in LTL+ proximal tubules. U-well culture shows the highest transduction efficiency among those four conditions.

AAVS1_site_12

Guide  - [In Vitro] [Human]
Matched Fields: name : AAVS1_site_12 grnaLabId : AAVS1_site_12 guideTargetLocus : AAVS1
Targets AAVS1 safe harbor locus

AAV6-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice deliverySystemName : AAV symbol : AAV6-ZsGreen-Cre vectorName : AAV6-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAV8-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice deliverySystemName : AAV symbol : AAV8-ZsGreen-Cre vectorName : AAV8-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAVcc47-SaCas9-Ai9

Vector  - [In Vivo] [Mouse]
Matched Fields: symbol : AAVcc47-SaCas9-Ai9 vectorName : AAVcc47-SaCas9-Ai9 vectorSubtype : AAV
AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter

AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence

AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence

AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence

AAV7-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice deliverySystemName : AAV symbol : AAV7-ZsGreen-Cre vectorName : AAV7-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAV9-mCherry

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9-mCherry vectorName : AAV9-mCherry vectorSubtype : AAV
AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter

AAV9-SaCas9/guide DMD

Vector  - [In Vivo]
Matched Fields: guideSource : AAV encoded (see vector details) study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing - submission 3 deliverySystemName : AAV symbol : AAV9-SaCas9/guide DMD vectorName : AAV9-SaCas9/guide DMD vectorSubtype : AAV vectorAnnotatedMap : Filename: pt366-aav-cmv-nls-sacas9-nls-3xha-bghpa-u6-jcr183_human-dmd.gb
All-in-one vector casette (CMV-saCas9-U6-gRNA [human/rhesus DMD intron])

AAVcc47-CMV-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing deliverySystemName : AAV symbol : AAVcc47-CMV-Cre vectorName : AAVcc47-CMV-Cre vectorSubtype : AAV
AAVcc47 delivering CMV Cre Recombinase

AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2 vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA

AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence

AAV5-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice deliverySystemName : AAV symbol : AAV5-ZsGreen-Cre vectorName : AAV5-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAV9-Ai9-sgRNA1-CB-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9-Ai9-sgRNA1-CB-SaCas9 vectorName : AAV9-Ai9-sgRNA1-CB-SaCas9 description : AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus vectorSubtype : AAV
AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus

AAV9-CMV-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9-CMV-SaCas9 vectorName : AAV9-CMV-SaCas9 description : AAV serotype 9 delivering CMV driven SaCas9 vectorSubtype : AAV
AAV serotype 9 delivering CMV driven SaCas9

AAVcc47-Ai9-sgRNA1-CB-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc47-Ai9-sgRNA1-CB-SaCas9 vectorName : AAVcc47-Ai9-sgRNA1-CB-SaCas9 vectorSubtype : AAV
AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus

AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA

AAV-Pcsk9

Vector  - [In Vivo] [Mouse]
Matched Fields: symbol : AAV-Pcsk9 vectorName : AAV-Pcsk9

AAV.pU1a-SpCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: symbol : AAV.pU1a-SpCas9 vectorName : AAV.pU1a-SpCas9 vectorSubtype : AAV
Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS

AAVrh10-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice deliverySystemName : AAV symbol : AAVrh10-ZsGreen-Cre vectorName : AAVrh10-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAV2-SaCas9

Vector  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV symbol : AAV2-SaCas9 vectorName : AAV2-SaCas9 description : AAV expressing S. aureus Cas9 under control of the CMV promoter vectorSubtype : AAV
AAV expressing S. aureus Cas9 under control of the CMV promoter

AAV4-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice deliverySystemName : AAV symbol : AAV4-ZsGreen-Cre vectorName : AAV4-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAV9-Ai9-sgRNA1 + sgRNA2

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9-Ai9-sgRNA1 + sgRNA2 vectorName : AAV9-Ai9-sgRNA1 + sgRNA2 description : AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus vectorSubtype : AAV
AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus

AAV9-Ai9-sgRNA2-CB-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9-Ai9-sgRNA2-CB-SaCas9 vectorName : AAV9-Ai9-sgRNA2-CB-SaCas9 description : AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus vectorSubtype : AAV
AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus

AAVcc47-Ai9-sgRNA2-CB-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc47-Ai9-sgRNA2-CB-SaCas9 vectorName : AAVcc47-Ai9-sgRNA2-CB-SaCas9 vectorSubtype : AAV
AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus

AAVcc47-CMV-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc47-CMV-SaCas9 vectorName : AAVcc47-CMV-SaCas9 vectorSubtype : AAV
AAVcc47 delivering CMV driven SaCas9

AAVcc47-SaCas9/guide DMD

Vector  - [In Vivo]
Matched Fields: guideSource : AAV encoded (see vector details) study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing - submission 3 deliverySystemName : AAV symbol : AAVcc47-SaCas9/guide DMD vectorName : AAVcc47-SaCas9/guide DMD vectorSubtype : AAV vectorAnnotatedMap : Filename: pt366-aav-cmv-nls-sacas9-nls-3xha-bghpa-u6-jcr183_human-dmd.gb
All-in-one vector casette (CMV-saCas9-U6-gRNA [human/rhesus DMD intron])

AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA

AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA

AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA

AAV2-gRNA

Vector  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV symbol : AAV2-gRNA vectorName : AAV2-gRNA description : AAV expressing two sgRNAs targeting human DMD under control of U6 promoters and mCherry under control vectorSubtype : AAV
AAV expressing two sgRNAs targeting human DMD under control of U6 promoters and mCherry under control of the CMV promoter; pAAV[2gRNA]-mCherry-U6>{SagRNA#1*}:{SagRNA#2}

AAV3b-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice deliverySystemName : AAV symbol : AAV3b-ZsGreen-Cre vectorName : AAV3b-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAV9-CMV-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing deliverySystemName : AAV symbol : AAV9-CMV-Cre vectorName : AAV9-CMV-Cre description : AAV serotype 9 delivering CMV Cre Recombinase vectorSubtype : AAV
AAV serotype 9 delivering CMV Cre Recombinase

AAV9-GFP

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9-GFP vectorName : AAV9-GFP vectorSubtype : AAV
AAV2/9 self complementary vector expressing GFP driven by CBh promoter

AAV9_pTR_self comp 2xU6-Ai9 guides

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9_pTR_self comp 2xU6-Ai9 guides vectorName : AAV9_pTR_self comp 2xU6-Ai9 guides description : AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting vectorSubtype : AAV
AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene

AAVcc47-mCherry

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc47-mCherry vectorName : AAVcc47-mCherry vectorSubtype : AAV
AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter

AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1 vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA

AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA

AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence

AAVrh8-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice deliverySystemName : AAV symbol : AAVrh8-ZsGreen-Cre vectorName : AAVrh8-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAVcc47-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: symbol : AAVcc47-Cre vectorName : AAVcc47-Cre vectorSubtype : AAV
AAV2/5 expressing Cre recombinase

AAV9-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice deliverySystemName : AAV symbol : AAV9-ZsGreen-Cre vectorName : AAV9-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAVcc47-Ai9-sgRNA1 + sgRNA2

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc47-Ai9-sgRNA1 + sgRNA2 vectorName : AAVcc47-Ai9-sgRNA1 + sgRNA2 description : AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus vectorSubtype : AAV
AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus

AAVcc47_pTR_self comp 2xU6-Ai9 guides

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc47_pTR_self comp 2xU6-Ai9 guides vectorName : AAVcc47_pTR_self comp 2xU6-Ai9 guides vectorSubtype : AAV
AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene

AAVcc81-GFP

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc81-GFP vectorName : AAVcc81-GFP vectorSubtype : AAV
AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter

AAVcc84-GFP

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc84-GFP vectorName : AAVcc84-GFP vectorSubtype : AAV
AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter

AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence

AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1

Vector  - [In Vitro] [Mouse]
Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1.gb
AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence

AAVrh74-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice deliverySystemName : AAV symbol : AAVrh74-ZsGreen-Cre vectorName : AAVrh74-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

Tsai_T Cell Transfection Protocol

Protocol  - [In Vitro] [Biological Effects] [Human]
Matched Fields: grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 guideTargetLocus : AAVS1
Procedure for T cell transfection.

Analysis of editing outcomes and adverse events in human kidney organoids

Experiment  - [In Vitro] [Biological Effects] [Human]
Matched Fields: guideTargetLocus : AAVS1
Freedman Benjamin S  Last Updated Date: 2025-02-14 NIH Report
 
Kidney organoids were derived from a human iPS cell line expressing GFP from the safe harbor locus. These were transfected with a commercially available CRISPR ribonucleoprotein complex with guide RNA targeting GFP or a scrambled sequence (control). Editing events were assessed by next generation sequencing of the GFP locus.

CRISPRMAX

Delivery System  - [In Vitro] [Human]
Matched Fields: guideTargetLocus : AAVS1

GFP-cRNA

Guide  - [In Vitro] [Human]
Matched Fields: guideTargetLocus : AAVS1

Alt-R™ S.p. HiFi Cas9 Nuclease V3

Genome Editor  - [In Vitro] [Human]
Matched Fields: guideTargetLocus : AAVS1
Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. Has improved specificity based on reduced off-target effects.

Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intravenous administration to rhesus macaques

Experiment  - [In Vivo] [Delivery Systems]
Matched Fields: guideSource : AAV encoded (see vector details) study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing - submission 3 deliverySystemName : AAV vectorName : AAVcc47-SaCas9/guide DMD AAV9-SaCas9/guide DMD vectorSubtype : AAV name : Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intravenous administration to vectorAnnotatedMap : Filename: pt366-aav-cmv-nls-sacas9-nls-3xha-bghpa-u6-jcr183_human-dmd.gb
Asokan Aravind  Last Updated Date: 2025-10-29 NIH Report
 
Phase I, AAV9 (n=4) and AAVcc47 (n=4) were administered via intravenous injection in rhesus macaques and organs were harvested 4 weeks post injection.

Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.

Experiment  - [In Vitro] [Biological Effects] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA vectorSubtype : AAV name : Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.
Morizane Ryuji  Last Updated Date: 2023-09-22 NIH Report
 
An AAV2 viral vector carrying SaCas9 and AAV2 vector expressing mCherry and carrying two gRNAs against the DMD gene were used in human kidney organoids to assess transgene delivery to nephron epithelia. Organoids were treated with both AAVs at MOI 10^5 for one week. Delivery of Cas9 and gRNA vectors to nephron cell types were evaluted by immunohistochemistry. Note: additional data not shown demonstrated mCherry and SaCas9 were not detectable in non-transduced cells.

Testing AAV5 for activation of tdTomato in HEK293T cells

Experiment  - [In Vitro] [Delivery Systems] [Human]
Matched Fields: vectorName : PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) description : AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T name : Testing AAV5 for activation of tdTomato in HEK293T cells
Gao Guang-Ping  Last Updated Date: 2020-10-20 NIH Report
 
AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence.

Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.

Experiment  - [In Vitro] [Biological Effects] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV name : Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.
Morizane Ryuji  Last Updated Date: 2023-09-22 NIH Report
 
Human kidney organoids generated from human iPS cells are used to evaluate toxicity induced by AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 . KIM-1 levels were measured using Luminex (Bioplex 200).

Ai9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice Evolving High Potency AAV Vectors for Neuromuscular Genome Editing deliverySystemName : AAV AAV+Focused Ultrasound vectorName : AAVrh8-ZsGreen-Cre AAVcc47-CMV-SaCas9 AAV9-CMV-SaCas9 AAV6-ZsGreen-Cre AAV4-ZsGreen-Cre vectorSubtype : AAV capsidSerotype : AAV BI28 (novel engineered variant)
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.
Show Experiments (11)

Cre recombinase

Genome Editor  - [In Vivo, In Vitro] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing deliverySystemName : AAV vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAVcc47-Cre AAV9-CMV-Cre AAVcc47-SaCas9-Ai9 AAVcc47-CMV-Cre description : Cre recombinase delivered by AAV (see vector details) vectorSubtype : AAV vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
Cre recombinase delivered by AAV (see vector details)

DMD low gRNA-2

Guide  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA description : One of two low-off target gRNAs delivred by dual gRNA AAV vector AAV-gRNA vectorSubtype : AAV
One of two low-off target gRNAs delivred by dual gRNA AAV vector AAV-gRNA

Cre Recombinase dose escalation study in Ai9 mice

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing deliverySystemName : AAV vectorName : AAV9-CMV-Cre AAVcc47-CMV-Cre vectorSubtype : AAV
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images.

RRID:AB_2336558 

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2-SaCas9 AAV2/8CMVeGFP AAV2-gRNA vectorSubtype : AAV
Other Id: Ab9498 (Abcam) Ab205402 (Abcam) B-1325-2 (Vector Labs) Ab13970 (Abcam) AF1658 (R&D Systems) Ab11512 (Abcam) Ab32570 (Abcam) A01951 (GenScript)
Lotus tetragonolobus lectin (LTL)

RRID:AB_354920 

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV
Other Id: Ab9498 (Abcam) B-1325-2 (Vector Labs) Ab13970 (Abcam) AF1658 (R&D Systems) Ab11512 (Abcam) Ab32570 (Abcam)
Goat anti-podocalyxin polyclonal antibody

Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids.

Experiment  - [In Vitro] [Biological Effects] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV name : Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids
Morizane Ryuji  Last Updated Date: 2023-09-22 NIH Report
 
Human kidney organoids generated from human ES are used to evaluate toxicity and inflammation induced by AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 . MCP-1 and KIM-1 levels were measured using Luminex (Bioplex 200).

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-Ai9-sgRNA1 + sgRNA2 AAVcc47-Ai9-sgRNA1 + sgRNA2 AAVcc47-CMV-SaCas9 AAV9-CMV-SaCas9 description : single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV vectorSubtype : AAV name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

SaCas9 (AAV-SaCas9)

Genome Editor  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA description : SaCas9 delivered by AAV-SaCas9 vector vectorSubtype : AAV
SaCas9 delivered by AAV-SaCas9 vector

FUS (focused ultrasound) array validation in Ai9 mice

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: deliverySystemName : AAV+Focused Ultrasound vectorSubtype : AAV
Leong Kam W  Last Updated Date: 2022-04-15 NIH Report
 
9.3 week-old Ai9 mice (4 male and 4 female) were administered Ai9-targeting SaCas9 AAV9 vector through intravenous adminsitration (2E12 vg/mouse) and left hemisphere was targeted by FUS (focused ultrasound) array for BBB (blood brain barrier) opening

SaCas9

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: deliverySystemName : AAV+Focused Ultrasound vectorSubtype : AAV

Human kidney organoid (iPSC-derived)

Model System  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV
Kidney organoid derived from human male BJFF iPS cells

SaCas9

Genome Editor  - [In Vivo]
Matched Fields: guideSource : AAV encoded (see vector details) study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing - submission 3 deliverySystemName : AAV vectorName : AAVcc47-SaCas9/guide DMD AAV9-SaCas9/guide DMD vectorSubtype : AAV vectorAnnotatedMap : Filename: pt366-aav-cmv-nls-sacas9-nls-3xha-bghpa-u6-jcr183_human-dmd.gb

DMD low gRNA-1

Guide  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA description : One of two low-off target gRNAs delivred by dual gRNA AAV vector pAAV[2gRNA]-mCherry-U6>{SagRNA#1*}:{ vectorSubtype : AAV
One of two low-off target gRNAs delivred by dual gRNA AAV vector pAAV[2gRNA]-mCherry-U6>{SagRNA#1*}:{SagRNA#2}

JCR183

Guide  - [In Vivo]
Matched Fields: guideSource : AAV encoded (see vector details) study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing - submission 3 deliverySystemName : AAV vectorName : AAVcc47-SaCas9/guide DMD AAV9-SaCas9/guide DMD vectorSubtype : AAV vectorAnnotatedMap : Filename: pt366-aav-cmv-nls-sacas9-nls-3xha-bghpa-u6-jcr183_human-dmd.gb
guide targeting an intronic seqeunce within the Rhesus and human DMD gene

RRID:AB_300798 

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV
Other Id: Ab9498 (Abcam) B-1325-2 (Vector Labs) Ab13970 (Abcam) AF1658 (R&D Systems) Ab11512 (Abcam) Ab32570 (Abcam)
Chicken anti-GFP polyclonal antibody

RRID:AB_2116561 

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2-gRNA vectorSubtype : AAV
Other Id: Cell Signaling Technology Cat# 2577 Vector Laboratories Cat# B-1325 Active Motif Cat# 39795 Abcam Cat# ab9498 R and D Systems Cat# AF1750
Goat anti-KIM1/HAVCR

demo VV01-Cre

Vector  [Mouse]
Matched Fields: deliverySystemName : AAV
DEMO viral vector for demo purpose

demo VV03-Cre

Vector  [Mouse]
Matched Fields: deliverySystemName : AAV
DEMO viral vector for demo purpose

TLR-2 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: deliverySystemName : AAV+Focused Ultrasound
R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways.

Sa_Ai9_L

Guide  - [In Vivo] [Mouse]
Matched Fields: deliverySystemName : AAV+Focused Ultrasound vectorSubtype : AAV
This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016)

Human kidney organoid (ESC-derived)

Model System  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV
Kidney organoid derived from human female H9 embryonic stem cells

Human kidney organoid (stem cell-derived)

Model System  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2-SaCas9 AAV2/8CMVeGFP AAV2-gRNA vectorSubtype : AAV
Kidney organoid derived from human female H9 ES or BJFF iPS cells

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA vectorSubtype : AAV
Other Id:
mouse anti-saCas9 monoclonal antibody

RRID:AB_2722769 

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA vectorSubtype : AAV
Other Id: Ab205402 (Abcam) B-1325-2 (Vector Labs) A01951 (GenScript)
Chicken anti-mCherry antibody

RRID:AB_307284 

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2-gRNA vectorSubtype : AAV
Other Id: Cell Signaling Technology Cat# 2577 Vector Laboratories Cat# B-1325 Active Motif Cat# 39795 Abcam Cat# ab9498 R and D Systems Cat# AF1750
Mouse anti-CD31 antibody

RRID:AB_2336558 

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2-gRNA vectorSubtype : AAV
Other Id: Cell Signaling Technology Cat# 2577 Vector Laboratories Cat# B-1325 Active Motif Cat# 39795 Abcam Cat# ab9498 R and D Systems Cat# AF1750
Lotus tetragonolobus lectin (LTL)

demo VV02-Cre

Vector  [Mouse]
Matched Fields: deliverySystemName : AAV
DEMO viral vector for demo purpose

demo VV04-Cre

Vector  [Mouse]
Matched Fields: deliverySystemName : AAV
DEMO viral vector for demo purpose

118. Focused ultrasound-mediated brain genome editing.

Publication  - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: deliverySystemName : AAV+Focused Ultrasound vectorSubtype : AAV
Lao YH, Ji R, Zhou JK, Snow KJ, Kwon N, Saville E, He S, Chauhan S, Chi CW, Datta MS, Zhang H, Quek CH, Cai SS, Li M, Gaitan Y, Bechtel L, Wu SY, Lutz CM, Tomer R, Murray SA, Chavez A, Konofagou EE, Leong KW
PUBMED: 37579143, PMC PMC10450663, DOI 10.1073/pnas.2302910120

ABSTRACT: Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to ...
SCGE data tags...

RRID:AB_10563941 

Antibody  - [In Vivo] [Mouse]
Matched Fields: deliverySystemName : AAV+Focused Ultrasound
Other Id: Invitrogen, R10367
Polyclonal rabbit anti-RFP antibody

Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System

Project  - [In Vivo, In Vitro] [Delivery Systems]
Matched Fields: name : Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central
Deverman Benjamin E  Last Updated Date: 2021-04-17 NIH Report
 
This project aims to advance the NIH Somatic Cell Genome Editing Program’s objective to identify novel delivery technologies that enable genome editing in therapeutically relevant somatic cell populations. We will use proven virus engineering methods to develop new vehicles that can deliver genome editing machinery throughout the adult mammalian central nervous system. Accomplishing this objective would pave the road for applying gene editing, and gene therapy more broadly, to the study and treatment of neurological and psychiatric disorders.

SaCas9-Lagor

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-Ai9-sgRNA2-CB-SaCas9 AAVcc47-Ai9-sgRNA2-CB-SaCas9 AAV9-Ai9-sgRNA1 + sgRNA2 AAVcc47-CMV-SaCas9 AAV9-CMV-SaCas9 vectorSubtype : AAV

122. CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity.

Publication  - [In Vitro] [Biological Effects] [Human]
Matched Fields: grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 guideTargetLocus : AAVS1
Lazzarotto CR, Malinin NL, Li Y, Zhang R, Yang Y, Lee G, Cowley E, He Y, Lan X, Jividen K, Katta V, Kolmakova NG, Petersen CT, Qi Q, Strelcov E, Maragh S, Krenciute G, Ma J, Cheng Y, Tsai SQ
PII: 10.1038/s41587-020-0555-7, PUBMED 32541958, PMC PMC7652380, MID NIHMS1591991, DOI 10.1038/s41587-020-0555-7

ABSTRACT: Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily scalable to the throughput needed to fully understand the principles that govern Cas9 specificity. Here we describe 'circularization for high-throughput analysis of nuclease genome-wide effects by sequencing' (CHANGE-seq), a scalable, automatable tagmentation-based method for measuring the genome-wide activity of Cas9 in vitro. We applied CHANGE-seq to 110 single guide RNA targets across 13 thera ...
SCGE data tags...

CD4/CD8 Human Primary T cell

Model System  - [In Vitro] [Human]
Matched Fields: grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 guideTargetLocus : AAVS1
CD4/CD8 Human Primary T cell

C57BL/6 mouse (Asokan study)

Model System  - [In Vivo] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-mCherry AAVcc47-mCherry AAVcc84-GFP AAVcc81-GFP AAV9-GFP vectorSubtype : AAV

Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-mCherry AAVcc47-mCherry vectorSubtype : AAV
Asokan Aravind  Last Updated Date: 2020-11-19 NIH Report
 
C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.

BI28:AAV-GFAP-SaCas9-WPRE3-pA

Vector  - [In Vivo] [Mouse]
Matched Fields: description : Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein vectorSubtype : AAV capsidSerotype : AAV BI28 (novel engineered variant)
Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter

Deverman_Comprehensive Methods

Protocol  - [In Vivo, In Vitro] [Delivery Systems] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 description : Procedure for plasmid cloning, editing evaluation in fibroblast, AAV production and administration, tissue vectorSubtype : AAV vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb capsidSerotype : AAV BI28 (novel engineered variant)
Procedure for plasmid cloning, editing evaluation in fibroblast, AAV production and administration, tissue processing and IHC.

A novel human T cell platform to define biological adverse effects of genome editing

Experiment  - [In Vitro] [Biological Effects] [Human]
Matched Fields: grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 guideTargetLocus : AAVS1
Tsai Shengdar Q  Last Updated Date: 2020-12-09 NIH Report
 
110 guide RNAs and SpCas9 were transfected into human T-cells. Indel rates were measured by targeted amplicon deep sequencing.

P3 Nucleofection Kit

Delivery System  - [In Vitro] [Human]
Matched Fields: grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 guideTargetLocus : AAVS1
Nuceleofection kit to be used with Lonza's nucleofection system.

SpCas9

Genome Editor  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 vectorName : AAV.pU1a-SpCas9 PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV guideTargetLocus : AAVS1
HA-SV40NLS-SpCas9-SV40NLS

RRID:AB_298118 

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV
Other Id: Ab9498 (Abcam) B-1325-2 (Vector Labs) Ab13970 (Abcam) AF1658 (R&D Systems) Ab11512 (Abcam) Ab32570 (Abcam)
Rat anti-e-cadherin monoclonal antibody

RRID:AB_777165 

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV
Other Id: Ab9498 (Abcam) B-1325-2 (Vector Labs) Ab13970 (Abcam) AF1658 (R&D Systems) Ab11512 (Abcam) Ab32570 (Abcam)
Rabbit anti-PDGFRb monoclonal antibody

RRID:AB_2750570 

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2-gRNA vectorSubtype : AAV
Other Id: Cell Signaling Technology Cat# 2577 Vector Laboratories Cat# B-1325 Active Motif Cat# 39795 Abcam Cat# ab9498 R and D Systems Cat# AF1750
Mouse anti-meis1/2/3

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-Ai9-sgRNA2-CB-SaCas9 AAVcc47-Ai9-sgRNA2-CB-SaCas9 AAVcc47-Ai9-sgRNA1-CB-SaCas9 AAV9-Ai9-sgRNA1-CB-SaCas9 vectorSubtype : AAV name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

Testing AAV5 for activation of tdTomato in mouse airway

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV name : Testing AAV5 for activation of tdTomato in mouse airway
Gao Guang-Ping  Last Updated Date: 2020-10-20 NIH Report
 
AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation

kidney organoid

Model System  - [In Vitro] [Human]
Matched Fields: guideTargetLocus : AAVS1
kidney organoid derived from human iPS cells

Deverman_AAV Production and Administration Protocol

Protocol  - [In Vitro] [Delivery Systems] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 description : Published procedures for AAV production, delivery, and tissue imaging. Challis et al. Systemic AAV vectors for widespread and targeted gene delivery in rodents. vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
Published procedures for AAV production, delivery, and tissue imaging. Challis et al. Systemic AAV vectors for widespread and targeted gene delivery in rodents. Nat Protoc. 2019 Feb;14(2):379-414. doi: 10.1038/s41596-018-0097-3.

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9_pTR_self comp 2xU6-Ai9 guides AAV9-CMV-SaCas9 AAVcc47_pTR_self comp 2xU6-Ai9 guides vectorSubtype : AAV name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intramuscular administration to rhesus macaques

Experiment  - [In Vivo] [Delivery Systems]
Matched Fields: guideSource : AAV encoded (see vector details) study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing - submission 3 vectorName : AAVcc47-SaCas9/guide DMD AAV9-SaCas9/guide DMD vectorSubtype : AAV name : Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intramuscular administration vectorAnnotatedMap : Filename: pt366-aav-cmv-nls-sacas9-nls-3xha-bghpa-u6-jcr183_human-dmd.gb
Asokan Aravind  Last Updated Date: 2025-10-29 NIH Report
 
Phase II, AAV9 (n=4) and AAVcc47 (n=4) were administered via intramuscular injection in rhesus macaques and organs were harvested 4 weeks post injection.

Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.

Experiment  - [In Vitro] [Biological Effects] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2-gRNA vectorSubtype : AAV name : Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2
Morizane Ryuji  Last Updated Date: 2023-09-22 NIH Report
 
AAV2 that carries saCas9 and AAV2 carrying two gRNAs against DMD gene and mCherry were used in kidney organoids to assess toxicity compared to AAV2-GFP or mock transduced kidney organoids.

RRID:AB_307284 

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV
Other Id: Ab9498 (Abcam) B-1325-2 (Vector Labs) Ab13970 (Abcam) AF1658 (R&D Systems) Ab11512 (Abcam) Ab32570 (Abcam)
Mouse anti-CD31 monoclonal antibody

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA vectorSubtype : AAV
Other Id:
mouse anti-saCas9 monoclonal antibody

RRID:AB_2118010 

Antibody  - [In Vitro] [Human]
Matched Fields: deliverySystemName : AAV vectorName : AAV2-gRNA vectorSubtype : AAV
Other Id: Cell Signaling Technology Cat# 2577 Vector Laboratories Cat# B-1325 Active Motif Cat# 39795 Abcam Cat# ab9498 R and D Systems Cat# AF1750
Rabbit anti-Phospho-Histone H2A.X (Ser139)

demo VV05-Cre

Vector  [Mouse]
Matched Fields: deliverySystemName : AAV
DEMO viral vector for demo purpose

Testing gRNA sequence and gRNA scaffold modified in Ai9 mice.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: description : 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 vectorSubtype : AAV capsidSerotype : AAV BI28 (novel engineered variant)
Deverman Benjamin E  Last Updated Date: 2021-04-17 NIH Report
 
3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later.

[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: description : Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing vectorSubtype : AAV name : Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to capsidSerotype : AAV BI28 (novel engineered variant)
Heaney Jason D  Last Updated Date: 2023-05-10 NIH Report
 
Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice

Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-Ai9-sgRNA1 + sgRNA2 AAVcc47-Ai9-sgRNA1 + sgRNA2 AAVcc47-CMV-SaCas9 AAV9-CMV-SaCas9 description : single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV vectorSubtype : AAV name : Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

Sa_Ai9_R

Guide  - [In Vivo] [Mouse]
Matched Fields: deliverySystemName : AAV+Focused Ultrasound vectorSubtype : AAV
This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016)

Ai9LR21-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: deliverySystemName : AAV+Focused Ultrasound vectorSubtype : AAV
AAV9 encoding S. aureus Cas9 and two guide RNAs with modified scaffolds

Deverman_Area Based Quantification of Editing Efficiency Protocol

Protocol  - [In Vivo, In Vitro] [Delivery Systems] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorSubtype : AAV vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb capsidSerotype : AAV BI28 (novel engineered variant)
Procedure for non-IHC based image quantification of editing.

L2-modified

Guide  - [In Vivo, In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorSubtype : AAV vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb capsidSerotype : AAV BI28 (novel engineered variant)
This gRNA targets the Ai9 and related transgenes

L3-modifed

Guide  - [In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
This gRNA targets the Ai9 and related transgenes

L3-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
This gRNA targets the Ai9 and related transgenes

R2-modified

Guide  - [In Vivo, In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorSubtype : AAV vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb capsidSerotype : AAV BI28 (novel engineered variant)
This gRNA targets the Ai9 and related transgenes

SaLoxP1-modified

Guide  - [In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
This gRNA targets the mTmG, Ai9 and related transgenes at two sites

SaLoxP1-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
This gRNA targets the mTmG, Ai9 and related transgenes at two sites

SaLoxP2-modified

Guide  - [In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
This gRNA targets the mTmG, Ai9 and related transgenes at two sites

BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2

Vector  - [In Vivo] [Mouse]
Matched Fields: description : Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP vectorSubtype : AAV capsidSerotype : AAV BI28 (novel engineered variant)
Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds

Ai9 mouse immortalized fibroblasts

Model System  - [In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice

Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAVcc84-GFP AAVcc81-GFP AAV9-GFP vectorSubtype : AAV
Asokan Aravind  Last Updated Date: 2020-11-19 NIH Report
 
C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.

L1-modified

Guide  - [In Vivo, In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorSubtype : AAV vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb capsidSerotype : AAV BI28 (novel engineered variant)
This gRNA targets the Ai9 and related transgenes

L1-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
This gRNA targets the Ai9 and related transgenes

L2-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
This gRNA targets the Ai9 and related transgenes

Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV name : Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Gao Guang-Ping  Last Updated Date: 2021-09-21 NIH Report
 
AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.

R1-modified

Guide  - [In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
This gRNA targets the Ai9 and related transgenes

R2-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
This gRNA targets the Ai9 and related transgenes

SaCas9

Genome Editor  - [In Vivo, In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorSubtype : AAV vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb capsidSerotype : AAV BI28 (novel engineered variant)

Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing

Project  - [In Vitro] [Biological Effects]
Matched Fields: description : We will optimize kidney organoid generation and AAV transduction for assessment of adverse effects of
Morizane Ryuji  Last Updated Date: 2023-09-22 NIH Report
 
The proposed work will take advantage of the state-of-the-art technology of kidney organoids that we recently generated from human pluripotent stem cells (hPSCs) and further advance this technology toward the goal of establishing kidney tissue platforms for assessment of somatic genome editing. We will optimize kidney organoid generation and AAV transduction for assessment of adverse effects of CRISR genome editing. Further, we will incorporate the 3D-printed vascular system into kidney organoids to simulate in vivo pharmacokinetics and pharmacodynamics on chips.

Antibody  - [In Vivo] [Mouse]
Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV
Other Id:
Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300

Antibody  - [In Vivo] [Mouse]
Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV
Other Id:
Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000

Antibody  - [In Vivo] [Mouse]
Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV
Other Id:
Anti-RFP (Rabbit) Polyclonal Antibody

Ai9 SaCas9 Guide A

Guide  - [In Vivo] [Mouse]
Matched Fields: vectorName : AAVcc47-Cre AAVcc47-SaCas9-Ai9 vectorSubtype : AAV
This gRNA targets the Ai9 and related transgenes

Ai9 SaCas9 Guide B

Guide  - [In Vivo] [Mouse]
Matched Fields: vectorName : AAVcc47-Cre AAVcc47-SaCas9-Ai9 vectorSubtype : AAV
This gRNA targets the Ai9 and related transgenes

Antibody  - [In Vivo] [Mouse]
Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV
Other Id:
GFP (D5.1) XP Rabbit mAb antibody

Chaikof-Associated Protocol 2_Off-target editing AND Primers for sequencing analysis

Protocol  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: vectorName : AAV-Pcsk9
This protocol describes in vivo adminstration and subsequent analysis of off-target editing in the liver.

Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro

Experiment  - [In Vitro] [Delivery Systems] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
Deverman Benjamin E  Last Updated Date: 2021-04-17 NIH Report
 
Reporter transgene activation by SaCas9 gRNA target and modified scaffold sequences by transient transfection in immortalized Ai9 mouse fibroblasts

R1-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
This gRNA targets the Ai9 and related transgenes

SaLoxP2-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb
This gRNA targets the mTmG, Ai9 and related transgenes at two sites

TadA-8e V106W

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: vectorName : AAV-Pcsk9
Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W)

sgAi9L

Guide  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: vectorName : AAV.pU1a-SpCas9 PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV
This sgRNA targets the Ai9 and related transgenes

sgAi9R

Guide  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: vectorName : AAV.pU1a-SpCas9 PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV
This sgRNA targets the Ai9 and related transgenes

Heaney_SATC Tissue Processing, Imaging and Analysis

Protocol  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: vectorName : AAVcc47-Cre AAVcc47-SaCas9-Ai9 vectorSubtype : AAV capsidSerotype : AAV BI28 (novel engineered variant)
Procedure for tissue preparation, imaging and analysis.

SauCas9

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: vectorName : AAVcc47-Cre AAVcc47-SaCas9-Ai9 vectorSubtype : AAV

HEK-293T with Ai9 transient reporter assay

Model System  - [In Vitro] [Human]
Matched Fields: vectorName : PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)
HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.

Ai9 mouse (BCM)

Model System  - [In Vivo] [Mouse]
Matched Fields: vectorName : AAVcc47-Cre AAVcc47-SaCas9-Ai9 vectorSubtype : AAV
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.

188. Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins.

Publication  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: description : In vitro and in vivo off-target editing from eVLPs was virtually undetected, an improvement over AAV
Banskota S, Raguram A, Suh S, Du SW, Davis JR, Choi EH, Wang X, Nielsen SC, Newby GA, Randolph PB, Osborn MJ, Musunuru K, Palczewski K, Liu DR
PII: S0092-8674(21)01484-7, PUBMED 35021064, PMC PMC8809250, DOI 10.1016/j.cell.2021.12.021

ABSTRACT: Methods to deliver gene editing agents in vivo as ribonucleoproteins could offer safety advantages over nucleic acid delivery approaches. We report the development and application of engineered DNA-free virus-like particles (eVLPs) that efficiently package and deliver base editor or Cas9 ribonucleoproteins. By engineering VLPs to overcome cargo packaging, release, and localization bottlenecks, we developed fourth-generation eVLPs that mediate efficient base editing in several primary mouse and h ...
SCGE data tags...

pH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)

Vector  - [In Vitro] [Human]
Matched Fields: vectorName : PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)
AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP

Antibody  - [In Vivo] [Mouse]
Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV
Other Id:
Anti-RFP (RABBIT) Antibody

Antibody  - [In Vivo] [Mouse]
Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV
Other Id:
Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200

BCM_ssAAV5-Sp_sgB

Guide  - [In Vivo] [Mouse]
Matched Fields: vectorSubtype : AAV
This sgRNA targets the Ai9 and related transgenes

H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)

Vector  - [In Vivo] [Mouse]
Matched Fields: vectorName : H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV
AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP

Ai9-SauSpyCas9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: vectorSubtype : AAV
Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.

Cre recombinase

Genome Editor  - [In Vitro] [Human]
Matched Fields: vectorName : PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)
Cre recombinase delivered by plasmid (see vector details)

Lipofectamine 3000

Delivery System  - [In Vitro] [Human, Mouse]
Matched Fields: vectorName : PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)
Lipid nanoparticle

BCM_ssAAV5-Sa_sgB

Guide  - [In Vivo] [Mouse]
Matched Fields: vectorSubtype : AAV
This gRNA targets the Ai9 and related transgenes

BCM_ssAAV5-Sp_sgA

Guide  - [In Vivo] [Mouse]
Matched Fields: vectorSubtype : AAV
This sgRNA targets the Ai9 and related transgenes

SaCas9

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: vectorSubtype : AAV

[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: vectorSubtype : AAV
Heaney Jason D  Last Updated Date: 2021-03-30 NIH Report
 
AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway

205 results for aav

Category Name Description Source View Associated...
Delivery System AAV See vector details
Show Experiments (10)
Delivery System AAV+Focused Ultrasound See vector details Leong Lab
Experiment AAV Tropism project Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging
Protocol Conklin_Fast-Seq AAV Protocol Published procedure for AAV composition measurement using fast-seq. Maynard et al. Fast-Seq: A Simple Method for Rapid and Inexpensive Validation of Packaged Single-Stranded Adeno-Associated Viral Genomes in Academic Settings. Hum Gene Ther Methods . 2019 Dec;30(6):195-205. doi: 10.1089/hgtb.2019.110.
Protocol Heaney-SATC_Gao-Validation_Intratracheal Delivery of AAV in Mice Procedure for Intratracheal (IT) delivery of AAV in mouse lung.
Project SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice
Show Experiments (1)
Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing Recombinant adeno-associated viruses (AAV) have emerged as safe and effective vectors for clinical gene therapy applications including systemic treatment of neuromuscular diseases such as Spinal Muscular Atrophy (SMA), Duchenne Muscular Dystrophy (DMD), and Giant Axonal Neuropathy (GAN) amongst others. However, genome editing in neuromuscular tissue, in particular, is challenging. The current proposal is on a comprehensive and innovative approach to evolve high potency AAV variants for systemic neuromuscular genome editing.
Show Experiments (9)
Experiment AAV tropism in kidney organoids cultured under flow Human kidney organoids generated from human ES and iPS cells are used to evaluate tropism of AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiation day 21 to 28. Four culture conditions were tested: U-well suspension culture, static culture on gelbrin, low flow on a chip coated with gelbrin, and high flow on a chip coated with gelbrin. Immunohistochemistry was performed to visualize transduced cells with staining for podocytes (PODXL) and proximal tubules (LTL). AAV2/2 shows the highest transduction efficiency among three serotypes evaluated, and the GFP expression is highest in the static condition.
Experiment AAV tropism in kidney organoids derived from human pluripotent stem cells. Human kidney organoids generated from human ES and iPS cells are used to evaluate tropism of AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiaiton day 21 to 28. Immunohistochemistry is performed to visualize transduced cells with staining for podocytes (PODXL), proximal tubules (LTL), loops of Henle and distal nephrons (CDH1), interstitial stromal cells (PDGFRb), and endothelia (CD31). AAV2/2 shows the highest transduction efficiency among three serotypes evaluated, and the GFP expression is highest in proximal tubular cells.
Experiment [Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.
Publication Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing. Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attributes benchmarked against AAV serotype 9 as evidenced by robust reporter and therapeutic gene expression, Cre recombination and CRISPR genome editing in normal and diseased mouse models. Enhanced transduction efficiency of AAV.cc47 vectors is further corroborated in macaques and pigs, providing a strong rationale for potential clinical translation into human gene therapies. We envision that ccAAV vectors may not only improve predictive modeling in preclinical studies, but also clinical translatability by broadening the therapeutic window of AAV based gene therapies.
Experiment On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10.
Guide AAVS1_site_05 Targets AAVS1 safe harbor locus Lab IVT
Guide AAVS1_site_13 Targets AAVS1 safe harbor locus Lab IVT
Guide AAVS1_site_14 Targets AAVS1 safe harbor locus Lab IVT
Guide AAVS1_site_01 Targets AAVS1 safe harbor locus Lab IVT
Guide AAVS1_site_02 Targets AAVS1 safe harbor locus Lab IVT
Guide AAVS1_site_06 Targets AAVS1 safe harbor locus Lab IVT
Guide AAVS1_site_08 Targets AAVS1 safe harbor locus Lab IVT
Guide AAVS1_site_09 Targets AAVS1 safe harbor locus Lab IVT
Guide AAVS1_site_11 Targets AAVS1 safe harbor locus Lab IVT
Guide AAVS1_site_03 Targets AAVS1 safe harbor locus Lab IVT
Guide AAVS1_site_04 Targets AAVS1 safe harbor locus Lab IVT
Guide AAVS1_site_07 Targets AAVS1 safe harbor locus Lab IVT
Guide AAVS1_site_10 Targets AAVS1 safe harbor locus Lab IVT
Experiment AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Human kidney orgnaoids generated from human ES and iPS cells are used to evaluate tropism of AAV2 that expresses eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiation day 22 to 23. Four culture conditions are tested: full flow on a chip, pulsed flow on a chip, no flow on a chip, U-well suspension culture. Flow cytometry is performed to quantify the transduction efficiency in LTL+ proximal tubules. U-well culture shows the highest transduction efficiency among those four conditions.
Guide AAVS1_site_12 Targets AAVS1 safe harbor locus Lab IVT
Vector AAV6-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAV8-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAVcc47-SaCas9-Ai9 AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter Asokan Lab
Vector AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Deverman Lab
Vector AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Deverman Lab
Vector AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Deverman Lab
Vector AAV7-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAV9-mCherry AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter Asokan Lab
Vector AAV9-SaCas9/guide DMD All-in-one vector casette (CMV-saCas9-U6-gRNA [human/rhesus DMD intron]) Asokan/Gersbach Labs
Vector AAVcc47-CMV-Cre AAVcc47 delivering CMV Cre Recombinase Asokan Lab
Vector AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Deverman Lab
Vector AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Deverman Lab
Vector AAV2/2CMVeGFP CMV-eGFP University of Iowa Viral Vector Core
Vector AAV2/8CMVeGFP CMV-eGFP University of Iowa Viral Vector Core
Vector AAV5-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAV9-Ai9-sgRNA1-CB-SaCas9 AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Vector AAV9-CMV-SaCas9 AAV serotype 9 delivering CMV driven SaCas9 Asokan Lab
Vector AAVcc47-Ai9-sgRNA1-CB-SaCas9 AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Vector AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Deverman Lab
Vector AAV-Pcsk9
Vector AAV.pU1a-SpCas9 Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS Addgene
Vector AAVrh10-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAV2-SaCas9 AAV expressing S. aureus Cas9 under control of the CMV promoter VectorBuilder
Vector AAV4-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAV9-Ai9-sgRNA1 + sgRNA2 AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Asokan Lab
Vector AAV9-Ai9-sgRNA2-CB-SaCas9 AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Vector AAVcc47-Ai9-sgRNA2-CB-SaCas9 AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Vector AAVcc47-CMV-SaCas9 AAVcc47 delivering CMV driven SaCas9 Asokan Lab
Vector AAVcc47-SaCas9/guide DMD All-in-one vector casette (CMV-saCas9-U6-gRNA [human/rhesus DMD intron]) Asokan/Gersbach Labs
Vector AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Deverman Lab
Vector AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Deverman Lab
Vector AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Deverman Lab
Vector AAV2/9CMVeGFP CMV-eGFP University of Iowa Viral Vector Core
Vector AAV2-gRNA AAV expressing two sgRNAs targeting human DMD under control of U6 promoters and mCherry under control of the CMV promoter; pAAV[2gRNA]-mCherry-U6>{SagRNA#1*}:{SagRNA#2} VectorBuilder
Vector AAV3b-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAV9-CMV-Cre AAV serotype 9 delivering CMV Cre Recombinase Asokan Lab
Vector AAV9-GFP AAV2/9 self complementary vector expressing GFP driven by CBh promoter Asokan Lab
Vector AAV9_pTR_self comp 2xU6-Ai9 guides AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Asokan Lab
Vector AAVcc47-mCherry AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter Asokan Lab
Vector AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Deverman Lab
Vector AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Deverman Lab
Vector AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Deverman Lab
Vector AAVrh8-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAVcc47-Cre AAV2/5 expressing Cre recombinase Asokan Lab
Vector AAV9-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAVcc47-Ai9-sgRNA1 + sgRNA2 AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Asokan Lab
Vector AAVcc47_pTR_self comp 2xU6-Ai9 guides AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Asokan Lab
Vector AAVcc81-GFP AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter Asokan Lab
Vector AAVcc84-GFP AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter Asokan Lab
Vector AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Deverman Lab
Vector AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1 AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Deverman Lab
Vector AAVrh74-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Protocol Tsai_T Cell Transfection Protocol Procedure for T cell transfection.
Experiment Analysis of editing outcomes and adverse events in human kidney organoids Kidney organoids were derived from a human iPS cell line expressing GFP from the safe harbor locus. These were transfected with a commercially available CRISPR ribonucleoprotein complex with guide RNA targeting GFP or a scrambled sequence (control). Editing events were assessed by next generation sequencing of the GFP locus.
Delivery System CRISPRMAX Thermo Fisher
Guide GFP-cRNA IDT
Genome Editor Alt-R™ S.p. HiFi Cas9 Nuclease V3 Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. Has improved specificity based on reduced off-target effects. Integrated DNA Technologies (IDT)
Experiment Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intravenous administration to rhesus macaques Phase I, AAV9 (n=4) and AAVcc47 (n=4) were administered via intravenous injection in rhesus macaques and organs were harvested 4 weeks post injection.
Experiment Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. An AAV2 viral vector carrying SaCas9 and AAV2 vector expressing mCherry and carrying two gRNAs against the DMD gene were used in human kidney organoids to assess transgene delivery to nephron epithelia. Organoids were treated with both AAVs at MOI 10^5 for one week. Delivery of Cas9 and gRNA vectors to nephron cell types were evaluted by immunohistochemistry. Note: additional data not shown demonstrated mCherry and SaCas9 were not detectable in non-transduced cells.
Experiment Testing AAV5 for activation of tdTomato in HEK293T cells AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence.
Experiment Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids. Human kidney organoids generated from human iPS cells are used to evaluate toxicity induced by AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 . KIM-1 levels were measured using Luminex (Bioplex 200).
Model System Ai9 mouse Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The Jackson Laboratory
Show Experiments (11)
Genome Editor Cre recombinase Cre recombinase delivered by AAV (see vector details)
Guide DMD low gRNA-2 One of two low-off target gRNAs delivred by dual gRNA AAV vector AAV-gRNA VectorBuilder
Experiment Cre Recombinase dose escalation study in Ai9 mice A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images.
Antibody RRID:AB_2336558  Lotus tetragonolobus lectin (LTL)
Antibody RRID:AB_354920  Goat anti-podocalyxin polyclonal antibody
Experiment Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Human kidney organoids generated from human ES are used to evaluate toxicity and inflammation induced by AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 . MCP-1 and KIM-1 levels were measured using Luminex (Bioplex 200).
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Genome Editor SaCas9 (AAV-SaCas9) SaCas9 delivered by AAV-SaCas9 vector VectorBuilder
Experiment FUS (focused ultrasound) array validation in Ai9 mice 9.3 week-old Ai9 mice (4 male and 4 female) were administered Ai9-targeting SaCas9 AAV9 vector through intravenous adminsitration (2E12 vg/mouse) and left hemisphere was targeted by FUS (focused ultrasound) array for BBB (blood brain barrier) opening
Genome Editor SaCas9 Leong Lab
Model System Human kidney organoid (iPSC-derived) Kidney organoid derived from human male BJFF iPS cells Morizane lab
Genome Editor SaCas9 Asokan lab
Guide DMD low gRNA-1 One of two low-off target gRNAs delivred by dual gRNA AAV vector pAAV[2gRNA]-mCherry-U6>{SagRNA#1*}:{SagRNA#2} VectorBuilder
Guide JCR183 guide targeting an intronic seqeunce within the Rhesus and human DMD gene AAV encoded (see vector details)
Antibody RRID:AB_300798  Chicken anti-GFP polyclonal antibody
Antibody RRID:AB_2116561  Goat anti-KIM1/HAVCR
Vector demo VV01-Cre DEMO viral vector for demo purpose Virus Company X
Vector demo VV03-Cre DEMO viral vector for demo purpose Virus Company X
Model System TLR-2 mouse R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways. The Jackson Laboratory
Guide Sa_Ai9_L This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016)
Model System Human kidney organoid (ESC-derived) Kidney organoid derived from human female H9 embryonic stem cells Morizane lab
Model System Human kidney organoid (stem cell-derived) Kidney organoid derived from human female H9 ES or BJFF iPS cells Morizane lab
Antibody mouse anti-saCas9 monoclonal antibody
Antibody RRID:AB_2722769  Chicken anti-mCherry antibody
Antibody RRID:AB_307284  Mouse anti-CD31 antibody
Antibody RRID:AB_2336558  Lotus tetragonolobus lectin (LTL)
Vector demo VV02-Cre DEMO viral vector for demo purpose Virus Company X
Vector demo VV04-Cre DEMO viral vector for demo purpose Virus Company X
Publication Focused ultrasound-mediated brain genome editing. Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to the brain.
Antibody RRID:AB_10563941  Polyclonal rabbit anti-RFP antibody
Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System This project aims to advance the NIH Somatic Cell Genome Editing Program’s objective to identify novel delivery technologies that enable genome editing in therapeutically relevant somatic cell populations. We will use proven virus engineering methods to develop new vehicles that can deliver genome editing machinery throughout the adult mammalian central nervous system. Accomplishing this objective would pave the road for applying gene editing, and gene therapy more broadly, to the study and treatment of neurological and psychiatric disorders.
Genome Editor SaCas9-Lagor William Lagor, Baylor College Of Medicine
Publication CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity. Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily scalable to the throughput needed to fully understand the principles that govern Cas9 specificity. Here we describe 'circularization for high-throughput analysis of nuclease genome-wide effects by sequencing' (CHANGE-seq), a scalable, automatable tagmentation-based method for measuring the genome-wide activity of Cas9 in vitro. We applied CHANGE-seq to 110 single guide RNA targets across 13 therapeutically relevant loci in human primary T cells and identified 201,934 off-target sites, enabling the training of a machine learning model to predict off-target activity. Comparing matched genome-wide off-target, chromatin modification and accessibility, and transcriptional data, we found that cellular off-target activity was two to four times more likely to occur near active promoters, enhancers and transcribed regions. Finally, CHANGE-seq analysis of six targets across eight individual genomes revealed that human single-nucleotide variation had significant effects on activity at ~15.2% of off-target sites analyzed. CHANGE-seq is a simplified, sensitive and scalable approach to understanding the specificity of genome editors.
Model System CD4/CD8 Human Primary T cell CD4/CD8 Human Primary T cell Key Biologicals
Model System C57BL/6 mouse (Asokan study) Unspecified
Experiment Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.
Vector BI28:AAV-GFAP-SaCas9-WPRE3-pA Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter Deverman Lab
Protocol Deverman_Comprehensive Methods Procedure for plasmid cloning, editing evaluation in fibroblast, AAV production and administration, tissue processing and IHC.
Experiment A novel human T cell platform to define biological adverse effects of genome editing 110 guide RNAs and SpCas9 were transfected into human T-cells. Indel rates were measured by targeted amplicon deep sequencing.
Delivery System P3 Nucleofection Kit Nuceleofection kit to be used with Lonza's nucleofection system. Lonza #V4SP-3096
Genome Editor SpCas9 HA-SV40NLS-SpCas9-SV40NLS Vector Encoded
Antibody RRID:AB_298118  Rat anti-e-cadherin monoclonal antibody
Antibody RRID:AB_777165  Rabbit anti-PDGFRb monoclonal antibody
Antibody RRID:AB_2750570  Mouse anti-meis1/2/3
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Experiment Testing AAV5 for activation of tdTomato in mouse airway AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation
Model System kidney organoid kidney organoid derived from human iPS cells Coriell Institute for Medical Research
Protocol Deverman_AAV Production and Administration Protocol Published procedures for AAV production, delivery, and tissue imaging. Challis et al. Systemic AAV vectors for widespread and targeted gene delivery in rodents. Nat Protoc. 2019 Feb;14(2):379-414. doi: 10.1038/s41596-018-0097-3.
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Experiment Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intramuscular administration to rhesus macaques Phase II, AAV9 (n=4) and AAVcc47 (n=4) were administered via intramuscular injection in rhesus macaques and organs were harvested 4 weeks post injection.
Experiment Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids. AAV2 that carries saCas9 and AAV2 carrying two gRNAs against DMD gene and mCherry were used in kidney organoids to assess toxicity compared to AAV2-GFP or mock transduced kidney organoids.
Antibody RRID:AB_307284  Mouse anti-CD31 monoclonal antibody
Antibody mouse anti-saCas9 monoclonal antibody
Antibody RRID:AB_2118010  Rabbit anti-Phospho-Histone H2A.X (Ser139)
Vector demo VV05-Cre DEMO viral vector for demo purpose Virus Company X
Experiment Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later.
Experiment [Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice
Experiment Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Guide Sa_Ai9_R This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016)
Vector Ai9LR21-SaCas9 AAV9 encoding S. aureus Cas9 and two guide RNAs with modified scaffolds Leong Lab
Protocol Deverman_Area Based Quantification of Editing Efficiency Protocol Procedure for non-IHC based image quantification of editing.
Guide L2-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide L3-modifed This gRNA targets the Ai9 and related transgenes Vector encoded
Guide L3-unmodified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide R2-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide SaLoxP1-modified This gRNA targets the mTmG, Ai9 and related transgenes at two sites Vector encoded
Guide SaLoxP1-unmodified This gRNA targets the mTmG, Ai9 and related transgenes at two sites Vector encoded
Guide SaLoxP2-modified This gRNA targets the mTmG, Ai9 and related transgenes at two sites Vector encoded
Vector BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2 Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds Deverman Lab
Model System Ai9 mouse immortalized fibroblasts Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice
Experiment Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.
Guide L1-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide L1-unmodified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide L2-unmodified This gRNA targets the Ai9 and related transgenes Vector encoded
Experiment Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.
Guide R1-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide R2-unmodified This gRNA targets the Ai9 and related transgenes Vector encoded
Genome Editor SaCas9
Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing The proposed work will take advantage of the state-of-the-art technology of kidney organoids that we recently generated from human pluripotent stem cells (hPSCs) and further advance this technology toward the goal of establishing kidney tissue platforms for assessment of somatic genome editing. We will optimize kidney organoid generation and AAV transduction for assessment of adverse effects of CRISR genome editing. Further, we will incorporate the 3D-printed vascular system into kidney organoids to simulate in vivo pharmacokinetics and pharmacodynamics on chips.
Antibody Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300
Antibody Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000
Antibody Anti-RFP (Rabbit) Polyclonal Antibody
Guide Ai9 SaCas9 Guide A This gRNA targets the Ai9 and related transgenes Vector encoded
Guide Ai9 SaCas9 Guide B This gRNA targets the Ai9 and related transgenes Vector encoded
Antibody GFP (D5.1) XP Rabbit mAb antibody
Protocol Chaikof-Associated Protocol 2_Off-target editing AND Primers for sequencing analysis This protocol describes in vivo adminstration and subsequent analysis of off-target editing in the liver.
Delivery System eVLP engineered virus like particles Liu Lab
Experiment Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Reporter transgene activation by SaCas9 gRNA target and modified scaffold sequences by transient transfection in immortalized Ai9 mouse fibroblasts
Guide R1-unmodified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide SaLoxP2-unmodified This gRNA targets the mTmG, Ai9 and related transgenes at two sites Vector encoded
Genome Editor TadA-8e V106W Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W) Chaikof Lab
Guide sgAi9L This sgRNA targets the Ai9 and related transgenes IDT
Guide sgAi9R This sgRNA targets the Ai9 and related transgenes IDT
Protocol Heaney_SATC Tissue Processing, Imaging and Analysis Procedure for tissue preparation, imaging and analysis.
Genome Editor SauCas9
Model System HEK-293T with Ai9 transient reporter assay HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.
Model System Ai9 mouse (BCM) Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Baylor College of Medicine
Model System C57BL/6J mouse C57BL/6J WT mouse The Jackson Laboratory
Publication Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. Methods to deliver gene editing agents in vivo as ribonucleoproteins could offer safety advantages over nucleic acid delivery approaches. We report the development and application of engineered DNA-free virus-like particles (eVLPs) that efficiently package and deliver base editor or Cas9 ribonucleoproteins. By engineering VLPs to overcome cargo packaging, release, and localization bottlenecks, we developed fourth-generation eVLPs that mediate efficient base editing in several primary mouse and human cell types. Using different glycoproteins in eVLPs alters their cellular tropism. Single injections of eVLPs into mice support therapeutic levels of base editing in multiple tissues, reducing serum Pcsk9 levels 78% following 63% liver editing, and partially restoring visual function in a mouse model of genetic blindness. In vitro and in vivo off-target editing from eVLPs was virtually undetected, an improvement over AAV or plasmid delivery. These results establish eVLPs as promising vehicles for therapeutic macromolecule delivery that combine key advantages of both viral and nonviral delivery.
Vector pH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP Gao Lab
Antibody Anti-RFP (RABBIT) Antibody
Antibody Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200
Guide BCM_ssAAV5-Sp_sgB This sgRNA targets the Ai9 and related transgenes Vector encoded
Vector H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP Gao Lab
Model System Ai9-SauSpyCas9 mouse Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Baylor College of Medicine
Genome Editor Cre recombinase Cre recombinase delivered by plasmid (see vector details)
Delivery System Lipofectamine 3000 Lipid nanoparticle Thermo Fisher Scientific
Guide BCM_ssAAV5-Sa_sgB This gRNA targets the Ai9 and related transgenes Vector encoded
Vector ssAAV5-sgB.saCas9 Gao Lab
Guide BCM_ssAAV5-Sp_sgA This sgRNA targets the Ai9 and related transgenes Vector encoded
Genome Editor SaCas9 Vector Encoded (ssaav5-sga+sgb-u1a.gfp)
Vector scAAV5-Cre-GFP Gao Lab
Vector ssAAV5-sgA+sgB-U1A.GFP Gao Lab
Vector ssAAV5-spCas9 Gao Lab
Experiment [Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway
Genome Editor SpCas9 IDT