94 results for Ai9
94 results for Ai9
Ai9 mouseModel System - [In Vivo] [Mouse]Show Experiments (11)
|
Ai9-SauSpyCas9 mouseModel System - [In Vivo] [Mouse] |
Ai9 mouse immortalized fibroblastsModel System - [In Vitro] [Mouse] |
Ai9 mouse (BCM)Model System - [In Vivo] [Mouse] |
HEK-293T with Ai9 transient reporter assayModel System - [In Vitro] [Human]Show Experiments (1) |
Cre Recombinase dose escalation study in Ai9 miceExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
Testing gRNA sequence and gRNA scaffold modified in Ai9 mice.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
FUS (focused ultrasound) array validation in Ai9 miceExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitroExperiment - [In Vitro] [Delivery Systems] [Mouse]
|
Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 miceExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
Ai9LR21-SaCas9Vector - [In Vivo] [Mouse]Show Experiments (1) |
SaCas9Genome Editor - [In Vivo] [Mouse]Show Experiments (1) |
|
|
Ai14 mouse (congenic)Model System - [In Vivo] [Mouse]Show Experiments (7)
|
23. Focused ultrasound-mediated brain genome editing.Publication - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]PUBMED: 37579143, PMC PMC10450663, DOI 10.1073/pnas.2302910120 ABSTRACT: Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to ... SCGE data tags...
|
L1-modifiedGuide - [In Vivo, In Vitro] [Mouse]Show Experiments (3) |
Gong_Intracranial Injection Procedure for MiceProtocol - [In Vivo] [Delivery Systems] [Mouse] |
|
Other Id:
Ab104224
Rockland Cat# 600-401-379
A21202
Ab150155
A21207
13-0300
Anti-RFP (RABBIT) Antibody |
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
|
|
|
|
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
RNP-NC-no ligandDelivery System - [In Vivo, In Vitro] [Mouse]Show Experiments (4)
|
SauCas9Genome Editor - [In Vivo] [Mouse] |
AAVcc47-SaCas9-Ai9Vector - [In Vivo] [Mouse] |
Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
|
Other Id:
Ab104224
Rockland Cat# 600-401-379
A21202
Ab150155
A21207
13-0300
Abcam, mouse anti-NeuN |
|
|
|
|
sNLS-SpCas9-sNLSGenome Editor - [In Vivo, In Vitro] [Mouse]Show Experiments (6)
|
Murray-SATC_Gong-Validaiton_Gong Study ProtocolProtocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
Murray-SATC_Gong-Validation Brain Injection in Mice ProtocolProtocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
|
Other Id:
Ab104224
Rockland Cat# 600-401-379
A21202
Ab150155
A21207
13-0300
Thermo-Fisher, Rat anti-GFAP |
|
Other Id:
Ab104224
Rockland Cat# 600-401-379
A21202
Ab150155
A21207
13-0300
Invitrogen, Donkey anti-rabbit alexa fluor 594 |
|
Other Id:
Ab104224
Rockland Cat# 600-401-379
A21202
Ab150155
A21207
13-0300
Abcam, Donkey anti-rat alexa fluour 647 |
|
Other Id:
Ab104224
Rockland Cat# 600-401-379
A21202
Ab150155
A21207
13-0300
Invitrogen, Donkey anti-mouse alexafluor 488 |
Ai14 gRNAGuide - [In Vivo] [Mouse]Show Experiments (3)
|
Ai14 mouseModel System - [In Vivo] [Mouse] |
|
|
RNP-NC-CPPDelivery System - [In Vivo, In Vitro] [Mouse]Show Experiments (6)
|
RNP-NC-RVGDelivery System - [In Vivo] [Mouse] |
Sa_Ai9_LGuide - [In Vivo] [Mouse]Show Experiments (1) |
[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
sg298Guide - [In Vivo, In Vitro] [Mouse]Show Experiments (3) |
68. Canalostomy As a Surgical Approach to Local Drug Delivery into the Inner Ears of Adult and Neonatal Mice.Publication - [In Vivo] [Delivery Systems, Collaborative Opportunity Fund, Animal Reporter and Testing Center] [Mouse]PUBMED: 29889202, PMC PMC6101422, DOI 10.3791/57351 ABSTRACT: Local delivery of therapeutic drugs into the inner ear is a promising therapy for inner ear diseases. Injection through semicircular canals (canalostomy) has been shown to be a useful approach to local drug delivery into the inner ear. The goal of this article is to describe, in detail, the surgical techniques involved in canalostomy in both adult and neonatal mice. As indicated by fast-green dye and adeno-associated virus serotype 8 with the green fluorescent protein gene, the canalostomy facil ... SCGE data tags...
|
Sa_Ai9_RGuide - [In Vivo] [Mouse]Show Experiments (1) |
70. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain.Publication - [In Vivo] [Delivery Systems, Collaborative Opportunity Fund, Animal Reporter and Testing Center] [Mouse]PII: nn.2467, PUBMED 20023653, PMC PMC2840225, MID NIHMS165655, DOI 10.1038/nn.2467 ABSTRACT: The Cre/lox system is widely used in mice to achieve cell-type-specific gene expression. However, a strong and universally responding system to express genes under Cre control is still lacking. We have generated a set of Cre reporter mice with strong, ubiquitous expression of fluorescent proteins of different spectra. The robust native fluorescence of these reporters enables direct visualization of fine dendritic structures and axonal projections of the labeled neurons, which is useful in mappin ... SCGE data tags...
|
SaLoxP2-unmodifiedGuide - [In Vitro] [Mouse] |
Testing AAV5 for activation of tdTomato in mouse airwayExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
g-loxPbot_C12aGuide - [In Vivo] [Mouse] |
SaLoxP1-unmodifiedGuide - [In Vitro] [Mouse] |
AAVcc47-Ai9-sgRNA1-CB-SaCas9Vector - [In Vivo] [Mouse] |
SaLoxP1-modifiedGuide - [In Vitro] [Mouse] |
SaLoxP2-modifiedGuide - [In Vitro] [Mouse] |
AAV9_pTR_self comp 2xU6-Ai9 guidesVector - [In Vivo] [Mouse] |
AAVcc47-Ai9-sgRNA2-CB-SaCas9Vector - [In Vivo] [Mouse] |
AAV9-Ai9-sgRNA1 + sgRNA2Vector - [In Vivo] [Mouse] |
AAV9-Ai9-sgRNA2-CB-SaCas9Vector - [In Vivo] [Mouse] |
83. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing.Publication - [In Vivo] [Delivery Systems, DCC, AAV tropism, Animal Reporter and Testing Center] [Mouse]PII: 10.1038/s41467-022-33745-4, PUBMED 36210364, PMC PMC9548504, DOI 10.1038/s41467-022-33745-4 ABSTRACT: Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attrib ... SCGE data tags...
|
Podocyte-specific gene editing in human kidney organoidsExperiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] |
AAV9-Ai9-sgRNA1-CB-SaCas9Vector - [In Vivo] [Mouse] |
Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cellsExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
AAVcc47-Ai9-sgRNA1 + sgRNA2Vector - [In Vivo] [Mouse] |
AAVcc47_pTR_self comp 2xU6-Ai9 guidesVector - [In Vivo] [Mouse] |
Testing AAV5 for activation of tdTomato in HEK293T cellsExperiment - [In Vitro] [Delivery Systems] [Human]
|
sg298Guide - [In Vivo] [Mouse]Show Experiments (4)
|
AAV Tropism projectExperiment - [In Vivo] [AAV tropism] [Mouse] |
[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
Heaney_SATC Tissue Processing, Imaging and AnalysisProtocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse]Show Experiments (4)
|
Cre recombinaseGenome Editor - [In Vivo, In Vitro] [Mouse]Show Experiments (4)
|
94 results for Ai9
| Category | Name | Description | Source | View Associated... |
|---|---|---|---|---|
| Model System | Ai9 mouse | Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. | The Jackson Laboratory |
Show Experiments (11)
|
| Guide | Ai9 SaCas9 Guide A | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Model System | Ai9-SauSpyCas9 mouse | Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. | Baylor College of Medicine | |
| Model System | Ai9 mouse immortalized fibroblasts | Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice | ||
| Guide | Ai9 SaCas9 Guide B | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Model System | Ai9 mouse (BCM) | Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. | Baylor College of Medicine | |
| Model System | HEK-293T with Ai9 transient reporter assay | HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. |
Show Experiments (1) |
|
| Experiment | Cre Recombinase dose escalation study in Ai9 mice | A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images. | ||
| Experiment | Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. | 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later. | ||
| Experiment | FUS (focused ultrasound) array validation in Ai9 mice | 9.3 week-old Ai9 mice (4 male and 4 female) were administered Ai9-targeting SaCas9 AAV9 vector through intravenous adminsitration (2E12 vg/mouse) and left hemisphere was targeted by FUS (focused ultrasound) array for BBB (blood brain barrier) opening | ||
| Experiment | Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro | Reporter transgene activation by SaCas9 gRNA target and modified scaffold sequences by transient transfection in immortalized Ai9 mouse fibroblasts | ||
| Experiment | Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) | A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Experiment | [Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice | AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway | ||
| Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) | A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) | A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. | A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Vector | Ai9LR21-SaCas9 | AAV9 encoding S. aureus Cas9 and two guide RNAs with modified scaffolds | Leong Lab |
Show Experiments (1) |
| Genome Editor | SaCas9 | Leong Lab |
Show Experiments (1) |
|
| Antibody | RRID:AB_141607 | |||
| Model System | Ai14 mouse (congenic) | Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. | The Jackson Laboratory |
Show Experiments (7)
|
| Guide | BCM_ssAAV5-Sp_sgB | This sgRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | R1-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Publication | Focused ultrasound-mediated brain genome editing. | Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to the brain. | ||
| Delivery System | AAV+Focused Ultrasound | See vector details | Leong Lab |
Show Experiments (1) |
| Guide | BCM_ssAAV5-Sp_sgA | This sgRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | g-loxP2_C9 | This sgRNA targets the Ai9 and related transgenes | IDT | |
| Guide | L1-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded |
Show Experiments (3) |
| Guide | L2-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | sgAi9L | This sgRNA targets the Ai9 and related transgenes | IDT | |
| Guide | sgAi9L | This sgRNA targets the Ai9 and related transgenes | IDT | |
| Protocol | Gong_Intracranial Injection Procedure for Mice | Procedure for intracranial delivery to mouse brain. | ||
| Antibody | AB_2209751 | Anti-RFP (RABBIT) Antibody | ||
| Experiment | [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain | Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed. | ||
| Antibody | RRID:AB_10711040 | |||
| Antibody | RRID:AB_141637 | |||
| Experiment | [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain | Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice | ||
| Delivery System | RNP-NC-no ligand | The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. | Gong Lab |
Show Experiments (4)
|
| Genome Editor | SauCas9 | |||
| Vector | AAVcc47-Cre | AAV2/5 expressing Cre recombinase | Asokan Lab | |
| Vector | AAVcc47-SaCas9-Ai9 | AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter | Asokan Lab | |
| Experiment | Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. | Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression. | ||
| Antibody | AB_10711040 | Abcam, mouse anti-NeuN | ||
| Antibody | RRID:AB_2209751 | |||
| Antibody | RRID:AB_2813835 | |||
| Genome Editor | sNLS-SpCas9-sNLS | SpCas9 with N- and C-terminal SV40 NLS | Aldevron 9212-5MG |
Show Experiments (6)
|
| Protocol | Murray-SATC_Gong-Validaiton_Gong Study Protocol | Procedure for intracranial injection, immunofluorescence and imaging. | ||
| Protocol | Murray-SATC_Gong-Validation Brain Injection in Mice Protocol | Procedure for brain injection surgical procedure, pre- and post-operative care for mice. | ||
| Antibody | AB_2532994 | Thermo-Fisher, Rat anti-GFAP | ||
| Antibody | AB_141637 | Invitrogen, Donkey anti-rabbit alexa fluor 594 | ||
| Antibody | AB_2813835 | Abcam, Donkey anti-rat alexa fluour 647 | ||
| Antibody | AB_141607 | Invitrogen, Donkey anti-mouse alexafluor 488 | ||
| Guide | Ai14 gRNA | This sgRNA targets the Ai9 and related transgenes at multiple sites | IDT |
Show Experiments (3)
|
| Model System | Ai14 mouse | Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. | The Jackson Laboratory | |
| Antibody | RRID:AB_2532994 | |||
| Delivery System | RNP-NC-CPP | The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity | Gong Lab |
Show Experiments (6)
|
| Delivery System | RNP-NC-RVG | The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry | Gong Lab | |
| Guide | BCM_ssAAV5-Sa_sgB | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | L1-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | L3-modifed | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | L3-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | R1-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | R2-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | R2-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | Sa_Ai9_L | This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) |
Show Experiments (1) |
|
| Experiment | [Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. | Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues. | ||
| Guide | sg298 | This sgRNA targets the Ai9 and related transgenes at multiple sites | Synthego |
Show Experiments (3) |
| Guide | L2-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Publication | Canalostomy As a Surgical Approach to Local Drug Delivery into the Inner Ears of Adult and Neonatal Mice. | Local delivery of therapeutic drugs into the inner ear is a promising therapy for inner ear diseases. Injection through semicircular canals (canalostomy) has been shown to be a useful approach to local drug delivery into the inner ear. The goal of this article is to describe, in detail, the surgical techniques involved in canalostomy in both adult and neonatal mice. As indicated by fast-green dye and adeno-associated virus serotype 8 with the green fluorescent protein gene, the canalostomy facilitated broad distribution of injected reagents in the cochlea and vestibular end-organs with minimal damage to hearing and vestibular function. The surgery was successfully implemented in both adult and neonatal mice; indeed, multiple surgeries could be performed if required. In conclusion, canalostomy is an effective and safe approach to drug delivery into the inner ears of adult and neonatal mice and may be used to treat human inner ear diseases in the future. | ||
| Guide | Sa_Ai9_R | This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) |
Show Experiments (1) |
|
| Publication | A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. | The Cre/lox system is widely used in mice to achieve cell-type-specific gene expression. However, a strong and universally responding system to express genes under Cre control is still lacking. We have generated a set of Cre reporter mice with strong, ubiquitous expression of fluorescent proteins of different spectra. The robust native fluorescence of these reporters enables direct visualization of fine dendritic structures and axonal projections of the labeled neurons, which is useful in mapping neuronal circuitry, imaging and tracking specific cell populations in vivo. Using these reporters and a high-throughput in situ hybridization platform, we are systematically profiling Cre-directed gene expression throughout the mouse brain in several Cre-driver lines, including new Cre lines targeting different cell types in the cortex. Our expression data are displayed in a public online database to help researchers assess the utility of various Cre-driver lines for cell-type-specific genetic manipulation. | ||
| Guide | SaLoxP2-unmodified | This gRNA targets the mTmG, Ai9 and related transgenes at two sites | Vector encoded | |
| Guide | sgAi9R | This sgRNA targets the Ai9 and related transgenes | IDT | |
| Experiment | Testing AAV5 for activation of tdTomato in mouse airway | AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation | ||
| Guide | g-loxPbot_C12a | This sgRNA targets the Ai9 and related transgenes at two sites | IDT | |
| Guide | SaLoxP1-unmodified | This gRNA targets the mTmG, Ai9 and related transgenes at two sites | Vector encoded | |
| Vector | AAVcc47-Ai9-sgRNA1-CB-SaCas9 | AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
| Guide | SaLoxP1-modified | This gRNA targets the mTmG, Ai9 and related transgenes at two sites | Vector encoded | |
| Guide | SaLoxP2-modified | This gRNA targets the mTmG, Ai9 and related transgenes at two sites | Vector encoded | |
| Vector | AAV9_pTR_self comp 2xU6-Ai9 guides | AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene | Asokan Lab | |
| Vector | AAVcc47-Ai9-sgRNA2-CB-SaCas9 | AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAV9-Ai9-sgRNA1 + sgRNA2 | AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAV9-Ai9-sgRNA2-CB-SaCas9 | AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
| Publication | Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing. | Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attributes benchmarked against AAV serotype 9 as evidenced by robust reporter and therapeutic gene expression, Cre recombination and CRISPR genome editing in normal and diseased mouse models. Enhanced transduction efficiency of AAV.cc47 vectors is further corroborated in macaques and pigs, providing a strong rationale for potential clinical translation into human gene therapies. We envision that ccAAV vectors may not only improve predictive modeling in preclinical studies, but also clinical translatability by broadening the therapeutic window of AAV based gene therapies. | ||
| Experiment | Podocyte-specific gene editing in human kidney organoids | Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter. | ||
| Vector | AAV9-Ai9-sgRNA1-CB-SaCas9 | AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
| Experiment | Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells | AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types. | ||
| Vector | AAVcc47-Ai9-sgRNA1 + sgRNA2 | AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAVcc47_pTR_self comp 2xU6-Ai9 guides | AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene | Asokan Lab | |
| Experiment | Testing AAV5 for activation of tdTomato in HEK293T cells | AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence. | ||
| Guide | sg298 | This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases | Synthego |
Show Experiments (4)
|
| Experiment | AAV Tropism project | Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging | ||
| Experiment | [Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain | Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice | ||
| Protocol | Heaney_SATC Tissue Processing, Imaging and Analysis | Procedure for tissue preparation, imaging and analysis. |
Show Experiments (4)
|
|
| Genome Editor | Cre recombinase | Cre recombinase delivered by AAV (see vector details) |
Show Experiments (4)
|