94 results for Ai9

Ai9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: name : Ai9 mouse description : Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent guide : Sa_Ai9_L Sa_Ai9_R
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.
Show Experiments (11)

Ai9 mouse (BCM)

Model System  - [In Vivo] [Mouse]
Matched Fields: name : Ai9 mouse (BCM) description : Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.

Ai9 SaCas9 Guide A

Guide  - [In Vivo] [Mouse]
Matched Fields: name : Ai9 SaCas9 Guide A description : This gRNA targets the Ai9 and related transgenes guide : Ai9 SaCas9 Guide A
This gRNA targets the Ai9 and related transgenes

Ai9-SauSpyCas9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: name : Ai9-SauSpyCas9 mouse description : Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9
Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.

Ai9 mouse immortalized fibroblasts

Model System  - [In Vitro] [Mouse]
Matched Fields: name : Ai9 mouse immortalized fibroblasts description : Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice
Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice

Ai9 SaCas9 Guide B

Guide  - [In Vivo] [Mouse]
Matched Fields: name : Ai9 SaCas9 Guide B description : This gRNA targets the Ai9 and related transgenes guide : Ai9 SaCas9 Guide B
This gRNA targets the Ai9 and related transgenes

Cre Recombinase dose escalation study in Ai9 mice

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: name : Cre Recombinase dose escalation study in Ai9 mice description : A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images.

HEK-293T with Ai9 transient reporter assay

Model System  - [In Vitro] [Human]
Matched Fields: name : HEK-293T with Ai9 transient reporter assay description : HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing
HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.

FUS (focused ultrasound) array validation in Ai9 mice

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: name : FUS (focused ultrasound) array validation in Ai9 mice description : 9.3 week-old Ai9 mice (4 male and 4 female) were administered Ai9-targeting SaCas9 AAV9 vector through guide : Sa_Ai9_L Sa_Ai9_R
Leong Kam W  Last Updated Date: 2022-04-15 NIH Report
 
9.3 week-old Ai9 mice (4 male and 4 female) were administered Ai9-targeting SaCas9 AAV9 vector through intravenous adminsitration (2E12 vg/mouse) and left hemisphere was targeted by FUS (focused ultrasound) array for BBB (blood brain barrier) opening

Testing gRNA sequence and gRNA scaffold modified in Ai9 mice.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: name : Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. description : /mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9
Deverman Benjamin E  Last Updated Date: 2021-04-17 NIH Report
 
3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later.

Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro

Experiment  - [In Vitro] [Delivery Systems] [Mouse]
Matched Fields: name : Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus description : activation by SaCas9 gRNA target and modified scaffold sequences by transient transfection in immortalized Ai9
Deverman Benjamin E  Last Updated Date: 2021-04-17 NIH Report
 
Reporter transgene activation by SaCas9 gRNA target and modified scaffold sequences by transient transfection in immortalized Ai9 mouse fibroblasts

[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: name : Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9
Heaney Jason D  Last Updated Date: 2021-03-30 NIH Report
 
AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to description : This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 description : This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to description : This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to description : This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

Ai9LR21-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: symbol : Ai9LR21-SaCas9 guide : Sa_Ai9_L Sa_Ai9_R
AAV9 encoding S. aureus Cas9 and two guide RNAs with modified scaffolds

SaCas9

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: guide : Sa_Ai9_L Sa_Ai9_R

[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B
Heaney Jason D  Last Updated Date: 2021-03-30 NIH Report
 
Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.

RRID:AB_10711040 

Antibody  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA

RRID:AB_141607 

Antibody  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA

23. Focused ultrasound-mediated brain genome editing.

Publication  - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: guide : Sa_Ai9_L Sa_Ai9_R
Lao YH, Ji R, Zhou JK, Snow KJ, Kwon N, Saville E, He S, Chauhan S, Chi CW, Datta MS, Zhang H, Quek CH, Cai SS, Li M, Gaitan Y, Bechtel L, Wu SY, Lutz CM, Tomer R, Murray SA, Chavez A, Konofagou EE, Leong KW
PUBMED: 37579143, PMC PMC10450663, DOI 10.1073/pnas.2302910120

ABSTRACT: Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to ...
SCGE data tags...

AAV+Focused Ultrasound

Delivery System  - [In Vivo] [Mouse]
Matched Fields: guide : Sa_Ai9_L Sa_Ai9_R
See vector details

25. A robust and high-throughput Cre reporting and characterization system for the whole mouse brain.

Publication  - [In Vivo] [Delivery Systems, Collaborative Opportunity Fund, Animal Reporter and Testing Center] [Mouse]
Matched Fields: guide : Ai14 gRNA
Madisen L, Zwingman TA, Sunkin SM, Oh SW, Zariwala HA, Gu H, Ng LL, Palmiter RD, Hawrylycz MJ, Jones AR, Lein ES, Zeng H
PII: nn.2467, PUBMED 20023653, PMC PMC2840225, MID NIHMS165655, DOI 10.1038/nn.2467

ABSTRACT: The Cre/lox system is widely used in mice to achieve cell-type-specific gene expression. However, a strong and universally responding system to express genes under Cre control is still lacking. We have generated a set of Cre reporter mice with strong, ubiquitous expression of fluorescent proteins of different spectra. The robust native fluorescence of these reporters enables direct visualization of fine dendritic structures and axonal projections of the labeled neurons, which is useful in mappin ...
SCGE data tags...

AB_2209751 

Antibody  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA
Other Id: Ab104224  Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 
Anti-RFP (RABBIT) Antibody

Murray-SATC_Gong-Validation Brain Injection in Mice Protocol

Protocol  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: guide : Ai14 gRNA
Procedure for brain injection surgical procedure, pre- and post-operative care for mice.

Ai14 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

RRID:AB_2532994 

Antibody  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: guide : Ai14 gRNA
Murray Stephen A  Last Updated Date: 2023-05-10 NIH Report
 
Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice

Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: guide : Ai14 gRNA
Gong Shaoqin (Sarah)  Last Updated Date: 2020-10-28 NIH Report
 
Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression.

AB_2532994 

Antibody  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA
Other Id: Ab104224  Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 
Thermo-Fisher, Rat anti-GFAP

AB_10711040 

Antibody  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA
Other Id: Ab104224  Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 
Abcam, mouse anti-NeuN

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: guide : Ai14 gRNA
Murray Stephen A  Last Updated Date: 2023-07-18 NIH Report
 
Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed.

AB_2813835 

Antibody  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA
Other Id: Ab104224  Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 
Abcam, Donkey anti-rat alexa fluour 647

RNP-NC-CPP

Delivery System  - [In Vivo, In Vitro] [Mouse]
Matched Fields: guide : Ai14 gRNA
The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity

L3-modifed

Guide  - [In Vitro] [Mouse]
Matched Fields: description : This gRNA targets the Ai9 and related transgenes
This gRNA targets the Ai9 and related transgenes

sgAi9R

Guide  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: description : This sgRNA targets the Ai9 and related transgenes
This sgRNA targets the Ai9 and related transgenes

BCM_ssAAV5-Sp_sgB

Guide  - [In Vivo] [Mouse]
Matched Fields: description : This sgRNA targets the Ai9 and related transgenes
This sgRNA targets the Ai9 and related transgenes

g-loxP2_C9

Guide  - [In Vivo] [Mouse]
Matched Fields: description : This sgRNA targets the Ai9 and related transgenes
This sgRNA targets the Ai9 and related transgenes

L1-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: description : This gRNA targets the Ai9 and related transgenes
This gRNA targets the Ai9 and related transgenes

AAVcc47-SaCas9-Ai9

Vector  - [In Vivo] [Mouse]
Matched Fields: guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B
AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter

Sa_Ai9_R

Guide  - [In Vivo] [Mouse]
Matched Fields: description : This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) guide : Sa_Ai9_R
This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016)

45. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing.

Publication  - [In Vivo] [Delivery Systems, DCC, AAV tropism, Animal Reporter and Testing Center] [Mouse]
Matched Fields: guide : Sa_Ai9_L Sa_Ai9_R
Gonzalez TJ, Simon KE, Blondel LO, Fanous MM, Roger AL, Maysonet MS, Devlin GW, Smith TJ, Oh DK, Havlik LP, Castellanos Rivera RM, Piedrahita JA, ElMallah MK, Gersbach CA, Asokan A
PII: 10.1038/s41467-022-33745-4, PUBMED 36210364, PMC PMC9548504, DOI 10.1038/s41467-022-33745-4

ABSTRACT: Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attrib ...
SCGE data tags...

AB_141607 

Antibody  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA
Other Id: Ab104224  Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 
Invitrogen, Donkey anti-mouse alexafluor 488

Murray-SATC_Gong-Validaiton_Gong Study Protocol

Protocol  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: guide : Ai14 gRNA
Procedure for intracranial injection, immunofluorescence and imaging.

Ai14 gRNA

Guide  - [In Vivo] [Mouse]
Matched Fields: description : This sgRNA targets the Ai9 and related transgenes at multiple sites guide : Ai14 gRNA
This sgRNA targets the Ai9 and related transgenes at multiple sites

g-loxPbot_C12a

Guide  - [In Vivo] [Mouse]
Matched Fields: description : This sgRNA targets the Ai9 and related transgenes at two sites
This sgRNA targets the Ai9 and related transgenes at two sites

L2-modified

Guide  - [In Vivo, In Vitro] [Mouse]
Matched Fields: description : This gRNA targets the Ai9 and related transgenes
This gRNA targets the Ai9 and related transgenes

L2-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: description : This gRNA targets the Ai9 and related transgenes
This gRNA targets the Ai9 and related transgenes

L3-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: description : This gRNA targets the Ai9 and related transgenes
This gRNA targets the Ai9 and related transgenes

R2-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: description : This gRNA targets the Ai9 and related transgenes
This gRNA targets the Ai9 and related transgenes

AAVcc47-Ai9-sgRNA2-CB-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: description : AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus
AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus

AAVcc47-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B
AAV2/5 expressing Cre recombinase

R1-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: description : This gRNA targets the Ai9 and related transgenes
This gRNA targets the Ai9 and related transgenes

R2-modified

Guide  - [In Vivo, In Vitro] [Mouse]
Matched Fields: description : This gRNA targets the Ai9 and related transgenes
This gRNA targets the Ai9 and related transgenes

sgAi9L

Guide  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: description : This sgRNA targets the Ai9 and related transgenes
This sgRNA targets the Ai9 and related transgenes

Ai14 mouse (congenic)

Model System  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

60. Canalostomy As a Surgical Approach to Local Drug Delivery into the Inner Ears of Adult and Neonatal Mice.

Publication  - [In Vivo] [Delivery Systems, Collaborative Opportunity Fund, Animal Reporter and Testing Center] [Mouse]
Matched Fields: guide : Ai14 gRNA
Guo JY, He L, Qu TF, Liu YY, Liu K, Wang GP, Gong SS
PUBMED: 29889202, PMC PMC6101422, DOI 10.3791/57351

ABSTRACT: Local delivery of therapeutic drugs into the inner ear is a promising therapy for inner ear diseases. Injection through semicircular canals (canalostomy) has been shown to be a useful approach to local drug delivery into the inner ear. The goal of this article is to describe, in detail, the surgical techniques involved in canalostomy in both adult and neonatal mice. As indicated by fast-green dye and adeno-associated virus serotype 8 with the green fluorescent protein gene, the canalostomy facil ...
SCGE data tags...

sg298

Guide  - [In Vivo, In Vitro] [Mouse]
Matched Fields: description : This sgRNA targets the Ai9 and related transgenes at multiple sites
This sgRNA targets the Ai9 and related transgenes at multiple sites

BCM_ssAAV5-Sa_sgB

Guide  - [In Vivo] [Mouse]
Matched Fields: description : This gRNA targets the Ai9 and related transgenes
This gRNA targets the Ai9 and related transgenes

BCM_ssAAV5-Sp_sgA

Guide  - [In Vivo] [Mouse]
Matched Fields: description : This sgRNA targets the Ai9 and related transgenes
This sgRNA targets the Ai9 and related transgenes

R1-modified

Guide  - [In Vitro] [Mouse]
Matched Fields: description : This gRNA targets the Ai9 and related transgenes
This gRNA targets the Ai9 and related transgenes

sgAi9L

Guide 
Matched Fields: description : This sgRNA targets the Ai9 and related transgenes
This sgRNA targets the Ai9 and related transgenes

AAV9-Ai9-sgRNA2-CB-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: description : AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus
AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus

Gong_Intracranial Injection Procedure for Mice

Protocol  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: guide : Ai14 gRNA
Procedure for intracranial delivery to mouse brain.

AB_141637 

Antibody  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA
Other Id: Ab104224  Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 
Invitrogen, Donkey anti-rabbit alexa fluor 594

RRID:AB_2209751 

Antibody  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA

RRID:AB_141637 

Antibody  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA

RRID:AB_2813835 

Antibody  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA

sNLS-SpCas9-sNLS

Genome Editor  - [In Vivo, In Vitro] [Mouse]
Matched Fields: guide : Ai14 gRNA
SpCas9 with N- and C-terminal SV40 NLS

RNP-NC-RVG

Delivery System  - [In Vivo] [Mouse]
Matched Fields: guide : Ai14 gRNA
The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry

SaLoxP1-modified

Guide  - [In Vitro] [Mouse]
Matched Fields: description : This gRNA targets the mTmG, Ai9 and related transgenes at two sites
This gRNA targets the mTmG, Ai9 and related transgenes at two sites

SauCas9

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B

Sa_Ai9_L

Guide  - [In Vivo] [Mouse]
Matched Fields: description : This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) guide : Sa_Ai9_L
This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016)

SaLoxP1-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: description : This gRNA targets the mTmG, Ai9 and related transgenes at two sites
This gRNA targets the mTmG, Ai9 and related transgenes at two sites

SaLoxP2-modified

Guide  - [In Vitro] [Mouse]
Matched Fields: description : This gRNA targets the mTmG, Ai9 and related transgenes at two sites
This gRNA targets the mTmG, Ai9 and related transgenes at two sites

SaLoxP2-unmodified

Guide  - [In Vitro] [Mouse]
Matched Fields: description : This gRNA targets the mTmG, Ai9 and related transgenes at two sites
This gRNA targets the mTmG, Ai9 and related transgenes at two sites

AAVcc47_pTR_self comp 2xU6-Ai9 guides

Vector  - [In Vivo] [Mouse]
Matched Fields: description : AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene
AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene

AAV9-Ai9-sgRNA1-CB-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: description : AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus
AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus

AAVcc47-Ai9-sgRNA1-CB-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: description : AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus
AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus

Testing AAV5 for activation of tdTomato in mouse airway

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: description : mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice.
Gao Guang-Ping  Last Updated Date: 2020-10-20 NIH Report
 
AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation

Podocyte-specific gene editing in human kidney organoids

Experiment  - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects]
Matched Fields: description : Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter Genome editing events were detected by induction of tdTomato from the Ai9 reporter.
Wilson Ross C. , Freedman Benjamin S  Last Updated Date: 2024-01-16
 
Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter.

Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: description : mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice.
Gao Guang-Ping  Last Updated Date: 2021-09-21 NIH Report
 
AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.

AAV9-Ai9-sgRNA1 + sgRNA2

Vector  - [In Vivo] [Mouse]
Matched Fields: description : AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus
AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus

AAVcc47-Ai9-sgRNA1 + sgRNA2

Vector  - [In Vivo] [Mouse]
Matched Fields: description : AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus
AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus

AAV9_pTR_self comp 2xU6-Ai9 guides

Vector  - [In Vivo] [Mouse]
Matched Fields: description : AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9
AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene

AAV Tropism project

Experiment  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: description : Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized
Lutz Cathleen M , Gao Guang-Ping , Heaney Jason D , Murray Stephen A , Lagor William Raymond , Dickinson Mary E  Last Updated Date: 2023-02-10
 
Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging

[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: description : Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9
Heaney Jason D  Last Updated Date: 2023-05-10 NIH Report
 
Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice

sg298

Guide  - [In Vivo] [Mouse]
Matched Fields: description : This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last
This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases

Testing AAV5 for activation of tdTomato in HEK293T cells

Experiment  - [In Vitro] [Delivery Systems] [Human]
Matched Fields: description : AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T
Gao Guang-Ping  Last Updated Date: 2020-10-20 NIH Report
 
AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence.

94 results for Ai9

Category Name Description Source View Associated...
Model System Ai9 mouse Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The Jackson Laboratory
Show Experiments (11)
Model System Ai9 mouse (BCM) Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Baylor College of Medicine
Guide Ai9 SaCas9 Guide A This gRNA targets the Ai9 and related transgenes Vector encoded
Model System Ai9-SauSpyCas9 mouse Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Baylor College of Medicine
Model System Ai9 mouse immortalized fibroblasts Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice
Guide Ai9 SaCas9 Guide B This gRNA targets the Ai9 and related transgenes Vector encoded
Experiment Cre Recombinase dose escalation study in Ai9 mice A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images.
Model System HEK-293T with Ai9 transient reporter assay HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.
Experiment FUS (focused ultrasound) array validation in Ai9 mice 9.3 week-old Ai9 mice (4 male and 4 female) were administered Ai9-targeting SaCas9 AAV9 vector through intravenous adminsitration (2E12 vg/mouse) and left hemisphere was targeted by FUS (focused ultrasound) array for BBB (blood brain barrier) opening
Experiment Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later.
Experiment Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Reporter transgene activation by SaCas9 gRNA target and modified scaffold sequences by transient transfection in immortalized Ai9 mouse fibroblasts
Experiment [Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Experiment Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Vector Ai9LR21-SaCas9 AAV9 encoding S. aureus Cas9 and two guide RNAs with modified scaffolds Leong Lab
Genome Editor SaCas9 Leong Lab
Experiment [Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.
Antibody RRID:AB_10711040 
Antibody RRID:AB_141607 
Delivery System RNP-NC-no ligand The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. Gong Lab
Publication Focused ultrasound-mediated brain genome editing. Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to the brain.
Delivery System AAV+Focused Ultrasound See vector details Leong Lab
Publication A robust and high-throughput Cre reporting and characterization system for the whole mouse brain. The Cre/lox system is widely used in mice to achieve cell-type-specific gene expression. However, a strong and universally responding system to express genes under Cre control is still lacking. We have generated a set of Cre reporter mice with strong, ubiquitous expression of fluorescent proteins of different spectra. The robust native fluorescence of these reporters enables direct visualization of fine dendritic structures and axonal projections of the labeled neurons, which is useful in mapping neuronal circuitry, imaging and tracking specific cell populations in vivo. Using these reporters and a high-throughput in situ hybridization platform, we are systematically profiling Cre-directed gene expression throughout the mouse brain in several Cre-driver lines, including new Cre lines targeting different cell types in the cortex. Our expression data are displayed in a public online database to help researchers assess the utility of various Cre-driver lines for cell-type-specific genetic manipulation.
Antibody AB_2209751  Anti-RFP (RABBIT) Antibody
Protocol Murray-SATC_Gong-Validation Brain Injection in Mice Protocol Procedure for brain injection surgical procedure, pre- and post-operative care for mice.
Model System Ai14 mouse Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory
Antibody RRID:AB_2532994 
Experiment [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice
Experiment Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression.
Antibody AB_2532994  Thermo-Fisher, Rat anti-GFAP
Antibody AB_10711040  Abcam, mouse anti-NeuN
Experiment [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed.
Antibody AB_2813835  Abcam, Donkey anti-rat alexa fluour 647
Delivery System RNP-NC-CPP The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity Gong Lab
Guide L1-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide L3-modifed This gRNA targets the Ai9 and related transgenes Vector encoded
Guide sgAi9R This sgRNA targets the Ai9 and related transgenes IDT
Guide BCM_ssAAV5-Sp_sgB This sgRNA targets the Ai9 and related transgenes Vector encoded
Guide g-loxP2_C9 This sgRNA targets the Ai9 and related transgenes IDT
Guide L1-unmodified This gRNA targets the Ai9 and related transgenes Vector encoded
Vector AAVcc47-SaCas9-Ai9 AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter Asokan Lab
Guide Sa_Ai9_R This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016)
Publication Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing. Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attributes benchmarked against AAV serotype 9 as evidenced by robust reporter and therapeutic gene expression, Cre recombination and CRISPR genome editing in normal and diseased mouse models. Enhanced transduction efficiency of AAV.cc47 vectors is further corroborated in macaques and pigs, providing a strong rationale for potential clinical translation into human gene therapies. We envision that ccAAV vectors may not only improve predictive modeling in preclinical studies, but also clinical translatability by broadening the therapeutic window of AAV based gene therapies.
Antibody AB_141607  Invitrogen, Donkey anti-mouse alexafluor 488
Protocol Murray-SATC_Gong-Validaiton_Gong Study Protocol Procedure for intracranial injection, immunofluorescence and imaging.
Guide Ai14 gRNA This sgRNA targets the Ai9 and related transgenes at multiple sites IDT
Guide g-loxPbot_C12a This sgRNA targets the Ai9 and related transgenes at two sites IDT
Guide L2-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide L2-unmodified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide L3-unmodified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide R2-unmodified This gRNA targets the Ai9 and related transgenes Vector encoded
Vector AAVcc47-Ai9-sgRNA2-CB-SaCas9 AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Vector AAVcc47-Cre AAV2/5 expressing Cre recombinase Asokan Lab
Guide R1-unmodified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide R2-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide sgAi9L This sgRNA targets the Ai9 and related transgenes IDT
Model System Ai14 mouse (congenic) Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory
Publication Canalostomy As a Surgical Approach to Local Drug Delivery into the Inner Ears of Adult and Neonatal Mice. Local delivery of therapeutic drugs into the inner ear is a promising therapy for inner ear diseases. Injection through semicircular canals (canalostomy) has been shown to be a useful approach to local drug delivery into the inner ear. The goal of this article is to describe, in detail, the surgical techniques involved in canalostomy in both adult and neonatal mice. As indicated by fast-green dye and adeno-associated virus serotype 8 with the green fluorescent protein gene, the canalostomy facilitated broad distribution of injected reagents in the cochlea and vestibular end-organs with minimal damage to hearing and vestibular function. The surgery was successfully implemented in both adult and neonatal mice; indeed, multiple surgeries could be performed if required. In conclusion, canalostomy is an effective and safe approach to drug delivery into the inner ears of adult and neonatal mice and may be used to treat human inner ear diseases in the future.
Guide sg298 This sgRNA targets the Ai9 and related transgenes at multiple sites Synthego
Guide BCM_ssAAV5-Sa_sgB This gRNA targets the Ai9 and related transgenes Vector encoded
Guide BCM_ssAAV5-Sp_sgA This sgRNA targets the Ai9 and related transgenes Vector encoded
Guide R1-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide sgAi9L This sgRNA targets the Ai9 and related transgenes IDT
Vector AAV9-Ai9-sgRNA2-CB-SaCas9 AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Protocol Gong_Intracranial Injection Procedure for Mice Procedure for intracranial delivery to mouse brain.
Antibody AB_141637  Invitrogen, Donkey anti-rabbit alexa fluor 594
Antibody RRID:AB_2209751 
Antibody RRID:AB_141637 
Antibody RRID:AB_2813835 
Genome Editor sNLS-SpCas9-sNLS SpCas9 with N- and C-terminal SV40 NLS Aldevron 9212-5MG
Delivery System RNP-NC-RVG The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry Gong Lab
Guide SaLoxP1-modified This gRNA targets the mTmG, Ai9 and related transgenes at two sites Vector encoded
Genome Editor SauCas9
Guide Sa_Ai9_L This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016)
Guide SaLoxP1-unmodified This gRNA targets the mTmG, Ai9 and related transgenes at two sites Vector encoded
Guide SaLoxP2-modified This gRNA targets the mTmG, Ai9 and related transgenes at two sites Vector encoded
Guide SaLoxP2-unmodified This gRNA targets the mTmG, Ai9 and related transgenes at two sites Vector encoded
Vector AAVcc47_pTR_self comp 2xU6-Ai9 guides AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Asokan Lab
Vector AAV9-Ai9-sgRNA1-CB-SaCas9 AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Vector AAVcc47-Ai9-sgRNA1-CB-SaCas9 AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Experiment Testing AAV5 for activation of tdTomato in mouse airway AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation
Experiment Podocyte-specific gene editing in human kidney organoids Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter.
Experiment Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.
Vector AAV9-Ai9-sgRNA1 + sgRNA2 AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Asokan Lab
Protocol Heaney_SATC Tissue Processing, Imaging and Analysis Procedure for tissue preparation, imaging and analysis.
Vector AAVcc47-Ai9-sgRNA1 + sgRNA2 AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Asokan Lab
Vector AAV9_pTR_self comp 2xU6-Ai9 guides AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Asokan Lab
Genome Editor Cre recombinase Cre recombinase delivered by AAV (see vector details)
Experiment AAV Tropism project Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging
Experiment [Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice
Guide sg298 This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases Synthego
Experiment Testing AAV5 for activation of tdTomato in HEK293T cells AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence.