297 results for crispr
297 results for crispr
Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung DiseasesProject - [In Vivo, In Vitro] [Delivery Systems]
|
Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the BrainProject - [In Vivo] [Delivery Systems]
|
Alt-R™ CRISPR-Cas9 Negative Control crRNA #1Guide - [In Vitro] [Human]Show Experiments (1) |
Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
5. CRISPR-CasΦ from huge phages is a hypercompact genome editor.Publication - [In Vitro] [Genome Editors] [Human]PII: 369/6501/333, PUBMED 32675376, PMC PMC8207990, MID NIHMS1702779, DOI 10.1126/science.abb1400 ABSTRACT: CRISPR-Cas systems are found widely in prokaryotes, where they provide adaptive immunity against virus infection and plasmid transformation. We describe a minimal functional CRISPR-Cas system, comprising a single ~70-kilodalton protein, CasΦ, and a CRISPR array, encoded exclusively in the genomes of huge bacteriophages. CasΦ uses a single active site for both CRISPR RNA (crRNA) processing and crRNA-guided DNA cutting to target foreign nucleic acids. This hypercompact system is active in vitro an ... SCGE data tags...
|
Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic PeptidesProject - [In Vivo, In Vitro] [Delivery Systems]
Show Experiments (6)
|
Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and DonorsProject - [In Vivo, In Vitro] [Delivery Systems]
Show Experiments (11)
|
[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner earExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair SystemsProject - [In Vitro] [Genome Editors]
Show Experiments (1) |
10. CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity.Publication - [In Vitro] [Biological Effects] [Human]PII: 10.1038/s41587-020-0555-7, PUBMED 32541958, PMC PMC7652380, MID NIHMS1591991, DOI 10.1038/s41587-020-0555-7 ABSTRACT: Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily scalable to the throughput needed to fully understand the principles that govern Cas9 specificity. Here we describe 'circularization for high-throughput analysis of nuclease genome-wide effects by sequencing' (CHANGE-seq), a scalable, automatable tagmentation-based method for measuring the genome-wide activity of Cas9 in vitro. We applied CHANGE-seq to 110 single guide RNA targets across 13 thera ... SCGE data tags...
|
11. Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia.Publication - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Mouse, Rhesus macaque]PII: 10.1038/s41467-019-12922-y, PUBMED 31659165, PMC PMC6817825, DOI 10.1038/s41467-019-12922-y ABSTRACT: The delivery of biologic cargoes to airway epithelial cells is challenging due to the formidable barriers imposed by its specialized and differentiated cells. Among cargoes, recombinant proteins offer therapeutic promise but the lack of effective delivery methods limits their development. Here, we achieve protein and SpCas9 or AsCas12a ribonucleoprotein (RNP) delivery to cultured human well-differentiated airway epithelial cells and mouse lungs with engineered amphiphilic peptides. These shuttle ... SCGE data tags...
|
[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic PeptidesExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
[Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner earExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner earExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner earExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
CRISPRMAXDelivery System - [In Vitro] [Human]Show Experiments (1) |
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
GFP-cRNAGuide - [In Vitro] [Human]Show Experiments (1) |
kidney organoidModel System - [In Vitro] [Human]Show Experiments (1) |
Analysis of editing outcomes and adverse events in human kidney organoidsExperiment - [In Vitro] [Biological Effects] [Human]
|
[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
Focused Ultrasound-mediated Delivery of Gene-editing Elements to the Brain for Neurodegenerative DisordersProject - [In Vivo] [Delivery Systems]
Show Experiments (1) |
[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 miceExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
Podocyte-specific gene editing in human kidney organoidsExperiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] |
32. Focused ultrasound-mediated brain genome editing.Publication - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]PUBMED: 37579143, PMC PMC10450663, DOI 10.1073/pnas.2302910120 ABSTRACT: Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to ... SCGE data tags...
|
[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liverExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
FSD117D1Delivery System - [In Vitro] [Human] |
Alt-R™ S.p. HiFi Cas9 Nuclease V3Genome Editor - [In Vitro] [Human]Show Experiments (1) |
Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cellsExperiment - [In Vitro] [Delivery Systems] [Human]
|
Ai14 mouseModel System - [In Vivo] [Mouse] |
Antibody - [In Vivo] [Mouse]Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200 Show Experiments (1) |
Antibody - [In Vivo] [Mouse]Anti-RFP (Rabbit) Polyclonal Antibody Show Experiments (1) |
Cre recombinaseGenome Editor - [In Vitro] [Human]Show Experiments (1) |
HEK-293T with Ai9 transient reporter assayModel System - [In Vitro] [Human]Show Experiments (1) |
FSD159Delivery System - [In Vitro] [Human] |
FSD160Delivery System - [In Vitro] [Human] |
FSD168Delivery System - [In Vitro] [Human] |
FSD168 Disul.Delivery System - [In Vitro] [Human] |
FSD189Delivery System - [In Vitro] [Human] |
FSD286Delivery System - [In Vitro] [Human] |
FSD322Delivery System - [In Vitro] [Human] |
FSD330Delivery System - [In Vitro] [Human] |
FSD341Delivery System - [In Vitro] [Human] |
FSD347Delivery System - [In Vitro] [Human] |
FSD57d4Delivery System - [In Vitro] [Human] |
FSD63Delivery System - [In Vitro] [Human] |
FSX4Delivery System - [In Vitro] [Human] |
FSX7Delivery System - [In Vitro] [Human] |
pH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)Vector - [In Vitro] [Human]Show Experiments (1) |
Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.Experiment - [In Vitro] [Delivery Systems] [Human]
|
FSD112Delivery System - [In Vitro] [Human] |
FSD114Delivery System - [In Vitro] [Human] |
FSD115Delivery System - [In Vitro] [Human] |
FSD118Delivery System - [In Vitro] [Human] |
FSD121Delivery System - [In Vitro] [Human] |
FSD168D20Delivery System - [In Vitro] [Human]Show Experiments (1) |
FSD190Delivery System - [In Vitro] [Human] |
FSD222Delivery System - [In Vitro] [Human] |
FSD227Delivery System - [In Vitro] [Human] |
FSD234Delivery System - [In Vitro] [Human] |
FSD239Delivery System - [In Vitro] [Human] |
FSD287Delivery System - [In Vitro] [Human] |
FSD288Delivery System - [In Vitro] [Human] |
FSD291Delivery System - [In Vitro] [Human] |
FSD303Delivery System - [In Vitro] [Human] |
FSD310Delivery System - [In Vitro] [Human] |
FSD329Delivery System - [In Vitro] [Human] |
FSD333Delivery System - [In Vitro] [Human] |
FSD335Delivery System - [In Vitro] [Human] |
FSD339Delivery System - [In Vitro] [Human] |
FSD359Delivery System - [In Vitro] [Human] |
FSD367Delivery System - [In Vitro] [Human] |
FSD57d1Delivery System - [In Vitro] [Human] |
FSD57d5Delivery System - [In Vitro] [Human] |
FSX3Delivery System - [In Vitro] [Human] |
FSX8Delivery System - [In Vitro] [Human] |
H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)Vector - [In Vivo] [Mouse] |
S10Delivery System - [In Vivo, In Vitro] [Human, Mouse, Rhesus macaque]Show Experiments (12)
|
Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brainExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brainExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
STS118 (TLR-MCV1a; Sp_t2-PS:Sp_c20_TLR_MCV1a)Guide - [In Vivo] [Mouse] |
Gong_Intracranial Injection Procedure for MiceProtocol - [In Vivo] [Delivery Systems] [Mouse] |
Antibody - [In Vivo] [Mouse]Anti-RFP (RABBIT) Antibody Show Experiments (1) |
Testing AAV5 for activation of tdTomato in HEK293T cellsExperiment - [In Vitro] [Delivery Systems] [Human]
|
AsCas12a (IDT and Feldan Therapeutics)Genome Editor - [In Vivo] [Mouse] |
Antibody - [In Vivo] [Mouse]Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300 Show Experiments (1) |
Antibody - [In Vivo] [Mouse]Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000 Show Experiments (1) |
BALB/c mouseModel System - [In Vivo] [Mouse]Show Experiments (1) |
mTmG mouseModel System - [In Vivo] [Mouse] |
FSD132Delivery System - [In Vitro] [Human] |
FSD168 cyclicDelivery System - [In Vitro] [Human] |
FSD168d11Delivery System - [In Vitro] [Human] |
FSD186Delivery System - [In Vitro] [Human] |
FSD196Delivery System - [In Vitro] [Human] |
FSD215Delivery System - [In Vitro] [Human] |
FSD235Delivery System - [In Vitro] [Human] |
FSD236Delivery System - [In Vitro] [Human] |
FSD260Delivery System - [In Vitro] [Human] |
FSD305Delivery System - [In Vitro] [Human] |
FSD306Delivery System - [In Vitro] [Human] |
FSD307Delivery System - [In Vitro] [Human] |
FSD308Delivery System - [In Vitro] [Human] |
FSD316Delivery System - [In Vitro] [Human] |
FSD317Delivery System - [In Vitro] [Human] |
FSD318Delivery System - [In Vitro] [Human] |
FSD319Delivery System - [In Vitro] [Human] |
FSD323Delivery System - [In Vitro] [Human] |
FSD334Delivery System - [In Vitro] [Human] |
FSD364Delivery System - [In Vitro] [Human] |
FSD366Delivery System - [In Vitro] [Human] |
FSD368Delivery System - [In Vitro] [Human] |
FSD57d3Delivery System - [In Vitro] [Human] |
FSD57d6Delivery System - [In Vitro] [Human] |
FSX6Delivery System - [In Vitro] [Human] |
pAAV.pU1a-SpCas9Vector - [In Vitro] [Human]Show Experiments (1) |
Ai9-SauSpyCas9 mouseModel System - [In Vivo] [Mouse] |
Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brainExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
|
Other Id:
AB_2798820
Cas9 (S. pyogenes) (E7M1H) XP® Rabbit mAb antibody, Cell Signaling Technology |
Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing CenterExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cellsExperiment - [In Vitro] [Delivery Systems] [Mouse]
|
STS96 (PCSK9a; Sp_t2:Sp_c20_PCSK9a)Guide - [In Vitro] [Mouse]Show Experiments (1) |
Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cellsExperiment - [In Vitro] [Delivery Systems] [Human]
|
AsCas12a (Feldan Therapeutics)Genome Editor - [In Vitro] [Human] |
Testing AAV5 for activation of tdTomato in mouse airwayExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
FSD116d1Delivery System - [In Vitro] [Human] |
FSD122Delivery System - [In Vitro] [Human] |
FSD168d10Delivery System - [In Vitro] [Human] |
FSD168d12Delivery System - [In Vitro] [Human] |
FSD168d17Delivery System - [In Vitro] [Human] |
FSD193Delivery System - [In Vitro] [Human] |
FSD199Delivery System - [In Vitro] [Human] |
FSD228Delivery System - [In Vitro] [Human] |
FSD240Delivery System - [In Vitro] [Human] |
FSD283Delivery System - [In Vitro] [Human] |
FSD284Delivery System - [In Vitro] [Human] |
FSD297Delivery System - [In Vitro] [Human] |
FSD304Delivery System - [In Vitro] [Human] |
FSD332Delivery System - [In Vitro] [Human] |
FSD360Delivery System - [In Vitro] [Human] |
FSD361Delivery System - [In Vitro] [Human] |
FSD363Delivery System - [In Vitro] [Human] |
FSD365Delivery System - [In Vitro] [Human] |
FSD67Delivery System - [In Vitro] [Human] |
FSD94Delivery System - [In Vitro] [Human] |
FSD97Delivery System - [In Vitro] [Human] |
FSX1Delivery System - [In Vitro] [Human] |
S10DDelivery System - [In Vitro] [Human] |
S10-MODDelivery System - [In Vitro] [Human] |
Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblastsExperiment - [In Vitro] [Delivery Systems] [Mouse]
|
Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brainExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
HEK-293T-disrupted_GFP with MCV-mcherry-PuroModel System - [In Vitro] [Human] |
STS119 (TLR-MCV1b; Sp_t2:Sp_c20_TLR_MCV1b)Guide - [In Vitro] [Human] |
Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brainExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
|
Other Id:
AB_1196615
GFP (D5.1) XP Rabbit mAb antibody, Cell Signaling Technology Show Experiments (3)
|
Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cellsExperiment - [In Vitro] [Delivery Systems] [Human]
|
HEK-293T-disrupted_GFP-mcherry-PuroModel System - [In Vitro] [Human] |
Hepa1-6Model System - [In Vitro] [Mouse]Show Experiments (1) |
STS118 (TLR-MCV1a; Sp_t2:Sp_c20_TLR_MCV1a)Guide - [In Vitro] [Human] |
STS134 (PCSK9b; Sp_t2:Sp_c20_PCSK9b)Guide - [In Vitro] [Mouse]Show Experiments (1) |
Antibody - [In Vivo] [Mouse]GFP (D5.1) XP Rabbit mAb antibody Show Experiments (1) |
Gene editing in vitro by various peptide variants delivering Cas12a in NK cells.Experiment - [In Vitro] [Delivery Systems] [Human]
|
Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epitheliaExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
FS48Delivery System - [In Vitro] [Human]Show Experiments (1) |
FS66d6Delivery System - [In Vitro] [Human] |
FSD147Delivery System - [In Vitro] [Human] |
Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cellsExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
FSD168 Scr.Delivery System - [In Vitro] [Human] |
FSD188Delivery System - [In Vitro] [Human] |
FSD191Delivery System - [In Vitro] [Human] |
g-loxPbot_C12aGuide - [In Vivo] [Mouse] |
FSD216Delivery System - [In Vitro] [Human] |
McCray_CFTR_Cas9_Guide1Guide - [In Vitro] [Human]Show Experiments (1) |
FSD259Delivery System - [In Vitro] [Human] |
FSD289Delivery System - [In Vitro] [Human] |
FSD293Delivery System - [In Vitro] [Human] |
FSD331Delivery System - [In Vitro] [Human] |
FSD362Delivery System - [In Vitro] [Human] |
FSD57Delivery System - [In Vitro] [Human] |
FSD96Delivery System - [In Vitro] [Human] |
FSX2Delivery System - [In Vitro] [Human] |
FSX5Delivery System - [In Vitro] [Human] |
AAV.pU1a-SpCas9Vector - [In Vivo] [Mouse] |
S10 Scr.Delivery System - [In Vitro] [Human] |
CasΦ-2Genome Editor - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP16 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP23 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP4 (CasΦ-2)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP6 (CasΦ-3)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP7 (CasΦ-2)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP7 (CasΦ-3)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP9 (CasΦ-3)Guide - [In Vitro] [Human]Show Experiments (1) |
HEK-293-TgEF1a-eGFP-BSDModel System - [In Vitro] [Human]Show Experiments (1) |
SapI-GG stuffer (CasΦ-2)Guide - [In Vitro] [Human]Show Experiments (1) |
pPP394Vector - [In Vitro] [Human]Show Experiments (1) |
Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cellsExperiment - [In Vitro] [Delivery Systems] [Mouse]
|
Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cellsExperiment - [In Vitro] [Delivery Systems] [Human]
|
Neuro 2AModel System - [In Vitro] [Mouse]Show Experiments (1) |
SpyCas9-3xNLSGenome Editor - [In Vivo] [Mouse]Show Experiments (5)
|
STS120 (TLR1; Sp_t2:Sp_c20_TLR1)Guide - [In Vitro] [Human] |
STS135 (PCSK9c; Sp_t2:Sp_c20_PCSK9c)Guide - [In Vitro] [Mouse]Show Experiments (1) |
CasΦ-3Genome Editor - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP10 (CasΦ-3)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP11 (CasΦ-3)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP4 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP5 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP8 (CasΦ-2)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP9 (CasΦ-2)Guide - [In Vitro] [Human]Show Experiments (1) |
pPP444Vector - [In Vitro] [Human]Show Experiments (1) |
FSD114d1Delivery System - [In Vitro] [Human]Show Experiments (3)
|
FSD195Delivery System - [In Vitro] [Human]Show Experiments (3)
|
FSD262Delivery System - [In Vitro] [Human, Rhesus macaque]Show Experiments (4)
|
Testing newly discovered Biggie Phage editors in human cellsExperiment - [In Vitro] [Genome Editors] [Human]
|
Cas12j-GFP15 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP17 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP2 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP3 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP3 (CasΦ-2)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP5 (CasΦ-3)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP6 (CasΦ-2)Guide - [In Vitro] [Human]Show Experiments (1) |
FSD197Delivery System - [In Vitro] [Human]Show Experiments (3)
|
FSD238Delivery System - [In Vitro] [Human]Show Experiments (3)
|
FSD285Delivery System - [In Vitro] [Human]Show Experiments (3)
|
FSD315Delivery System - [In Vivo, In Vitro] [Human, Mouse, Rhesus macaque]Show Experiments (7)
|
FSD95Delivery System - [In Vitro] [Human, Rhesus macaque]Show Experiments (3)
|
CasΦ-1Genome Editor - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP14 (CasΦ-3)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP18 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP5 (CasΦ-2)Guide - [In Vitro] [Human]Show Experiments (1) |
SapI-GG stuffer (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
pPP441Vector - [In Vitro] [Human]Show Experiments (1) |
FSD237Delivery System - [In Vitro] [Human, Mouse, Rhesus macaque]Show Experiments (5)
|
FSD321Delivery System - [In Vitro] [Human, Rhesus macaque]Show Experiments (4)
|
FSD115d1Delivery System - [In Vitro] [Human]Show Experiments (3)
|
Primary Airway Epithelia (Human)Model System - [In Vitro] [Human]Show Experiments (4)
|
SpCas9 (Feldan Therapeutics)Genome Editor - [In Vitro] [Human, Mouse]Show Experiments (4)
|
FSD301Delivery System - [In Vitro] [Human]Show Experiments (3)
|
FSD63D1Delivery System - [In Vitro] [Human, Rhesus macaque]Show Experiments (3)
|
Cas12j-GFP10 (CasΦ-2)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP12 (CasΦ-3)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP13 (CasΦ-3)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP14 (CasΦ-2)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP19 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP1 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP1 (CasΦ-2)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP20 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP21 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP22 (CasΦ-1)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP2 (CasΦ-2)Guide - [In Vitro] [Human]Show Experiments (1) |
Cas12j-GFP8 (CasΦ-3)Guide - [In Vitro] [Human]Show Experiments (1) |
SapI-GG stuffer (CasΦ-3)Guide - [In Vitro] [Human]Show Experiments (1) |
Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous BlastocystsExperiment - [In Vitro] [Animal Reporter and Testing Center]
|
STS159 (mTmG; Sp_t2:Sp_c20_mTmG)Guide - [In Vivo, In Vitro] [Mouse]Show Experiments (4)
|
Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive controlExperiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] |
SpyCas9-3xNLSGenome Editor - [In Vivo, In Vitro] [Human, Mouse]Show Experiments (7)
|
285. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing.Publication - [In Vivo] [Delivery Systems, DCC, AAV tropism, Animal Reporter and Testing Center] [Mouse]PII: 10.1038/s41467-022-33745-4, PUBMED 36210364, PMC PMC9548504, DOI 10.1038/s41467-022-33745-4 ABSTRACT: Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attrib ... SCGE data tags...
|
|
Other Id:
Thermo Fisher Scientific Cat# G10362
Vector Labs Cat# BA-1000
GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362 Show Experiments (3)
|
Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model systemExperiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] |
Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model systemExperiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] |
mTmG mouse (congenic)Model System - [In Vivo] [Mouse]Show Experiments (7)
|
Ai14 gRNAGuide - [In Vivo] [Mouse]Show Experiments (3)
|
sNLS-SpCas9-sNLSGenome Editor - [In Vivo, In Vitro] [Mouse]Show Experiments (6)
|
RNP-NC-CPPDelivery System - [In Vivo, In Vitro] [Mouse]Show Experiments (6)
|
RNP-NC-no ligandDelivery System - [In Vivo, In Vitro] [Mouse]Show Experiments (4)
|
Ai9 mouseModel System - [In Vivo] [Mouse]Show Experiments (11)
|
Alt-R™ S.p. Cas9 Nuclease V3Genome Editor - [In Vivo, In Vitro] [Mouse]Show Experiments (10)
|
297 results for crispr
| Category | Name | Description | Source | View Associated... |
|---|---|---|---|---|
| Project | Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases | Efficacy and safety limitations in current gene editing technologies have hindered efforts to treat genetic lung diseases. This proposal seeks to develop and validate a combinatorial delivery approach that uses non-viral and viral vehicles to efficiently transport gene editing tools to disease-relevant cells in the lung. Completion of our work will establish safe and effective delivery vehicles that will guide the design of future gene therapies for genetic disorders. | ||
| Project | Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain | In vivo genome editing using CRISPR/Cas9 is anticipated to be the next wave of therapeutics for various major health threats, including neurodegenerative diseases. However, to date, very few Cas9-gRNA ribonucleoprotein in vivo delivery methods have been reported, and delivery to the brain has been particularly challenging. The unique nanocapsules we plan to develop will ultimately enable high efficiency neuron-targeted genome editing in the brain, thereby offering new hope to treat devastating neurodegenerative diseases. | ||
| Guide | Alt-R™ CRISPR-Cas9 Negative Control crRNA #1 | Non-targeting control guide | IDT |
Show Experiments (1) |
| Experiment | Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. | Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression. | ||
| Publication | CRISPR-CasΦ from huge phages is a hypercompact genome editor. | CRISPR-Cas systems are found widely in prokaryotes, where they provide adaptive immunity against virus infection and plasmid transformation. We describe a minimal functional CRISPR-Cas system, comprising a single ~70-kilodalton protein, CasΦ, and a CRISPR array, encoded exclusively in the genomes of huge bacteriophages. CasΦ uses a single active site for both CRISPR RNA (crRNA) processing and crRNA-guided DNA cutting to target foreign nucleic acids. This hypercompact system is active in vitro and in human and plant cells with expanded target recognition capabilities relative to other CRISPR-Cas proteins. Useful for genome editing and DNA detection but with a molecular weight half that of Cas9 and Cas12a genome-editing enzymes, CasΦ offers advantages for cellular delivery that expand the genome editing toolbox. | ||
| Project | Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides | The proposed research is relevant to the public health because genetic and acquired diseases affecting the airways pose major disease and economic burdens. By advancing the delivery of gene editing tools, it may be possible to therapeutically modify the cells lining the airways. This novel strategy has implications for the treatment of both monogenetic and acquired lungs disease, and may have applications for other somatic cell therapies. |
Show Experiments (6)
|
|
| Project | Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors | RNA-guided CRISPR genome editing systems promise to revolutionize the treatment of inherited disease. Safe, effective, and target-tissue-specific delivery of the guide RNA that directs editing is a critical hurdle in the development of clinical applications for engineered CRISPR systems. Using strategies validated for the delivery of other categories of nucleic acid therapeutics, we have established a framework for complete chemical modification of CRISPR guides, thereby conferring in vivo stability and effective biodistribution properties. The proposed research will optimize these guides, as well as other editing components, for clinical use. |
Show Experiments (11)
|
|
| Experiment | [Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear | Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice | ||
| Project | Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems | Expanding genome editing tools through exploration of new CRISPR-Cas proteins and DNA repair enzymes NARRATIVE Fundamental research on bacterial adaptive immunity uncovered the genome editing properties of CRISPR-Cas systems, and it is clear that uncultivated microbes contain more pathways and enzymes that may be useful as genome editing tools. We will combine bioinformatics and biochemistry to identify new DNA- and RNA-associating proteins and will analyze their mechanisms of action. We will focus our investigation on newly described CRISPR-Cas systems and DNA-interacting proteins that occur in conserved genomic context. |
Show Experiments (1) |
|
| Publication | CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity. | Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily scalable to the throughput needed to fully understand the principles that govern Cas9 specificity. Here we describe 'circularization for high-throughput analysis of nuclease genome-wide effects by sequencing' (CHANGE-seq), a scalable, automatable tagmentation-based method for measuring the genome-wide activity of Cas9 in vitro. We applied CHANGE-seq to 110 single guide RNA targets across 13 therapeutically relevant loci in human primary T cells and identified 201,934 off-target sites, enabling the training of a machine learning model to predict off-target activity. Comparing matched genome-wide off-target, chromatin modification and accessibility, and transcriptional data, we found that cellular off-target activity was two to four times more likely to occur near active promoters, enhancers and transcribed regions. Finally, CHANGE-seq analysis of six targets across eight individual genomes revealed that human single-nucleotide variation had significant effects on activity at ~15.2% of off-target sites analyzed. CHANGE-seq is a simplified, sensitive and scalable approach to understanding the specificity of genome editors. | ||
| Publication | Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia. | The delivery of biologic cargoes to airway epithelial cells is challenging due to the formidable barriers imposed by its specialized and differentiated cells. Among cargoes, recombinant proteins offer therapeutic promise but the lack of effective delivery methods limits their development. Here, we achieve protein and SpCas9 or AsCas12a ribonucleoprotein (RNP) delivery to cultured human well-differentiated airway epithelial cells and mouse lungs with engineered amphiphilic peptides. These shuttle peptides, non-covalently combined with GFP protein or CRISPR-associated nuclease (Cas) RNP, allow rapid entry into cultured human ciliated and non-ciliated epithelial cells and mouse airway epithelia. Instillation of shuttle peptides combined with SpCas9 or AsCas12a RNP achieves editing of loxP sites in airway epithelia of ROSAmT/mG mice. We observe no evidence of short-term toxicity with a widespread distribution restricted to the respiratory tract. This peptide-based technology advances potential therapeutic avenues for protein and Cas RNP delivery to refractory airway epithelial cells. | ||
| Experiment | [Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides | Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings | ||
| Experiment | [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain | Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed. | ||
| Experiment | [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain | Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice | ||
| Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) | A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Experiment | [Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain | Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections. | ||
| Experiment | [Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear | Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal. | ||
| Experiment | [Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear | Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed. | ||
| Experiment | [Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear | Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice | ||
| Delivery System | CRISPRMAX | Thermo Fisher |
Show Experiments (1) |
|
| Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) | A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Experiment | Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) | A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. | A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Guide | GFP-cRNA | IDT |
Show Experiments (1) |
|
| Model System | kidney organoid | kidney organoid derived from human iPS cells | Coriell Institute for Medical Research |
Show Experiments (1) |
| Experiment | Analysis of editing outcomes and adverse events in human kidney organoids | Kidney organoids were derived from a human iPS cell line expressing GFP from the safe harbor locus. These were transfected with a commercially available CRISPR ribonucleoprotein complex with guide RNA targeting GFP or a scrambled sequence (control). Editing events were assessed by next generation sequencing of the GFP locus. | ||
| Experiment | [Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. | Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues. | ||
| Experiment | [Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain | Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice | ||
| Project | Focused Ultrasound-mediated Delivery of Gene-editing Elements to the Brain for Neurodegenerative Disorders | Gene editing may offer a new therapeutic strategy to tackle many neurodegenerative disorders that remain untreatable. Current methodologies of delivering CRISPR-based gene editing elements to the brain are highly inefficient. We propose to develop a noninvasive, efficient approach to achieve gene editing in the brain using focused ultrasound technology. |
Show Experiments (1) |
|
| Experiment | [Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice | AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway | ||
| Experiment | Podocyte-specific gene editing in human kidney organoids | Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter. | ||
| Publication | Focused ultrasound-mediated brain genome editing. | Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to the brain. | ||
| Experiment | [Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver | Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced. | ||
| Delivery System | FSD117D1 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Genome Editor | Alt-R™ S.p. HiFi Cas9 Nuclease V3 | Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. Has improved specificity based on reduced off-target effects. | Integrated DNA Technologies (IDT) |
Show Experiments (1) |
| Experiment | Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells | Delivery of Cas12a RNP targeting human CFTR in Primary human epithelia cells. Gene editing efficiency was determined by percentage of NGS reads that showed an indel | ||
| Model System | Ai14 mouse | Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. | The Jackson Laboratory | |
| Antibody | Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200 |
Show Experiments (1) |
||
| Antibody | Anti-RFP (Rabbit) Polyclonal Antibody |
Show Experiments (1) |
||
| Genome Editor | Cre recombinase | Cre recombinase delivered by plasmid (see vector details) |
Show Experiments (1) |
|
| Model System | HEK-293T with Ai9 transient reporter assay | HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. |
Show Experiments (1) |
|
| Delivery System | FSD159 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD160 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD168 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD168 Disul. | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD189 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD286 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD322 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD330 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD341 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD347 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD57d4 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD63 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSX4 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSX7 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | S18 | Shuttle peptide | Feldan Therapeutics (synthetic peptide from GL Biochem, 95% purity) | |
| Vector | pH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) | AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP | Gao Lab |
Show Experiments (1) |
| Guide | 3849 45-5' | Targets endogenous human locus | IDT |
Show Experiments (1) |
| Experiment | Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. | Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells. | ||
| Experiment | Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. | In Vitro shuttle peptide delivery of Cas12a RNPs targeting human CFTR and HPRT genes in human primary airway epithelia. Editing efficiency was assessed after 72hrs by sanger sequencing. | ||
| Delivery System | CM18-PTD4 | Shuttle peptide | Feldan Therapeutics (synthetic peptide from GL Biochem, 95% purity) | |
| Delivery System | FSD112 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD114 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD115 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD118 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD121 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD168D20 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (1) |
| Guide | g-38330_C12a | gRNA targeting HPRT locus | IDT | |
| Delivery System | FSD190 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Guide | g-loxP2_C9 | This sgRNA targets the Ai9 and related transgenes | IDT | |
| Delivery System | FSD222 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD227 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD234 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD239 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD287 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD288 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD291 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD303 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD310 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD329 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD333 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD335 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD339 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD359 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD367 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD57d1 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD57d5 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSX3 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSX8 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | S85 | Shuttle peptide | Feldan Therapeutics (synthetic peptide from GL Biochem, 95% purity) | |
| Vector | H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) | AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP | Gao Lab | |
| Delivery System | S10 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (12)
|
| Experiment | Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain | Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged. | ||
| Experiment | Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain | Chemically modified crRNA and tracrRNA were injected into the striatum of TLR-MCV mice and the distribution of RNP was imaged. | ||
| Model System | Mouse Embryonic Fibroblasts | Primary cell line | In-house: https://jacks-lab.mit.edu/protocols/making_mefs | |
| Model System | TLR-MCV1 mouse | TLR-MCV1 transgene knocked into Rosa26 locus | ||
| Guide | STS118 (TLR-MCV1a; Sp_t2-PS:Sp_c20_TLR_MCV1a) | Targets traffic light reporter transgene, CY3 labeled | In house production | |
| Protocol | Gong_Intracranial Injection Procedure for Mice | Procedure for intracranial delivery to mouse brain. | ||
| Antibody | Anti-RFP (RABBIT) Antibody |
Show Experiments (1) |
||
| Experiment | Testing AAV5 for activation of tdTomato in HEK293T cells | AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence. | ||
| Genome Editor | AsCas12a (IDT and Feldan Therapeutics) | IDT and Feldan Therapeutics | ||
| Antibody | Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300 |
Show Experiments (1) |
||
| Antibody | Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000 |
Show Experiments (1) |
||
| Genome Editor | GFP-NLS | Nuclear targeted GFP | Expressed From (Escherichia coli BL21DE3) |
Show Experiments (1) |
| Model System | BALB/c mouse | BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). | The Jackson Laboratory |
Show Experiments (1) |
| Model System | mTmG mouse | ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence | The Jackson Laboratory | |
| Delivery System | FSD132 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD168 cyclic | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD168d11 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD186 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Guide | g-11_C9 | sgRNA targeting CFTR exon 11 | IDT | |
| Delivery System | FSD196 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD215 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD235 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD236 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD260 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD305 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD306 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD307 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD308 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD316 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD317 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD318 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD319 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD323 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD334 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD364 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD366 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD368 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD57d3 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD57d6 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSX6 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Vector | pAAV.pU1a-SpCas9 | Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS | Addgene |
Show Experiments (1) |
| Model System | Ai9-SauSpyCas9 mouse | Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. | Baylor College of Medicine | |
| Experiment | Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain | Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged. | ||
| Antibody | RRID:AB_2798820 | Cas9 (S. pyogenes) (E7M1H) XP® Rabbit mAb antibody, Cell Signaling Technology | ||
| Experiment | Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center | Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain | ||
| Experiment | Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells | Chemically modified crRNA and tracrRNA were delivered by electroporation to mouse Neuro2A cells. Editing activity was determined by Sanger sequencing | ||
| Guide | STS159 (mTmG; Sp_t2-PS:Sp_c20_mTmG) | This sgRNA targets the mTmG transgene | In house production | |
| Guide | STS96 (PCSK9a; Sp_t2:Sp_c20_PCSK9a) | Targets endogenous mouse locus | In house production |
Show Experiments (1) |
| Experiment | Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells | Delivery of Cas9 RNP targeting human CFTR in Primary human epithelia cells. Gene editing efficiency was determined by percentage of NGS reads that showed an indel | ||
| Genome Editor | AsCas12a (Feldan Therapeutics) | Feldan Therapeutics | ||
| Experiment | Testing AAV5 for activation of tdTomato in mouse airway | AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation | ||
| Delivery System | FSD116d1 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD122 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD168d10 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD168d12 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD168d17 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD168d20 | Shuttle peptide | Feldan Therapeutics (synthetic peptide from GL Biochem, 95% purity) |
Show Experiments (1) |
| Guide | g-45_C12a | gRNA targeting CFTR inton-22-23 | IDT | |
| Delivery System | FSD193 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD199 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD228 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD240 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD283 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD284 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD297 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD304 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD332 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD360 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Guide | sgAi9L | This sgRNA targets the Ai9 and related transgenes | IDT | |
| Delivery System | FSD361 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Guide | sgAi9R | This sgRNA targets the Ai9 and related transgenes | IDT | |
| Delivery System | FSD363 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD365 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD67 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD94 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD97 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSX1 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | S10D | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | S10-MOD | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Experiment | Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts | Chemically modified crRNA and tracrRNA were delivered by electroporation to embryonic fibroblasts harvested from the mTmG reporter mouse. Gene editing was determined by reporter activation. | ||
| Experiment | Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain | Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged. | ||
| Model System | HEK-293T-disrupted_GFP with MCV-mcherry-Puro | HEK293T cells with an integrated reporter for TLR-MCV1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. | ||
| Guide | STS119 (TLR-MCV1b; Sp_t2:Sp_c20_TLR_MCV1b) | Targets traffic light reporter transgene | In house production | |
| Experiment | Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain | Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged. | ||
| Antibody | RRID:AB_1196615 | GFP (D5.1) XP Rabbit mAb antibody, Cell Signaling Technology |
Show Experiments (3)
|
|
| Experiment | Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells | Chemically modified crRNA and tracrRNA were delivered by electroporation to transgenic human HEK-293T cells harboring the TLR1 reporter. Gene editing was determined by reporter activation. | ||
| Model System | HEK-293T-disrupted_GFP-mcherry-Puro | HEK293T cells with an integrated reporter for TLR1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. | ||
| Model System | Hepa1-6 | Stable mouse cell line of liver epithelial cells. | ATCC |
Show Experiments (1) |
| Guide | STS118 (TLR-MCV1a; Sp_t2:Sp_c20_TLR_MCV1a) | Targets traffic light reporter transgene | In house production | |
| Guide | STS134 (PCSK9b; Sp_t2:Sp_c20_PCSK9b) | Targets endogenous mouse locus | In house production |
Show Experiments (1) |
| Guide | STS159 (mTmG; Sp_t2:Sp_c0_mTmG) | This sgRNA targets the mTmG transgene | In house production | |
| Guide | STS205 (BACE1; Sp_t41:Sp_c20_Bace1) | Targets endogenous mouse locus | In house production | |
| Antibody | GFP (D5.1) XP Rabbit mAb antibody |
Show Experiments (1) |
||
| Experiment | Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. | In Vitro shuttle peptide delivery of Cas12a RNP targeting human NKG2A gene in human NK cells. Gene editing was assessed after 48hr by T7E1 digestion. | ||
| Experiment | Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia | In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells. | ||
| Delivery System | FS48 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (1) |
| Delivery System | FS66d6 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD147 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Experiment | Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells | AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types. | ||
| Model System | NK | Natural Killer cells. White blood cells; | GreenCross LabCell |
Show Experiments (1) |
| Delivery System | FSD168 Scr. | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD188 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD191 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Guide | g-loxPbot_C12a | This sgRNA targets the Ai9 and related transgenes at two sites | IDT | |
| Delivery System | FSD216 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Guide | McCray_CFTR_Cas9_Guide1 | Targets endogenous human locus | IDT |
Show Experiments (1) |
| Guide | NKG2A | gRNA targeting human NKG2A exon 3 | IDT |
Show Experiments (1) |
| Delivery System | FSD259 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD289 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD293 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD331 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD362 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD57 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSD96 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSX2 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Delivery System | FSX5 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Vector | AAV.pU1a-SpCas9 | Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS | Addgene | |
| Delivery System | S10 Scr. | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab | |
| Genome Editor | CasΦ-2 | Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies | Jennifer Doudna Lab |
Show Experiments (1) |
| Guide | Cas12j-GFP16 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP23 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP4 (CasΦ-2) | Guide targeting eGFP compatible with CasΦ-2 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP6 (CasΦ-3) | Guide targeting eGFP compatible with CasΦ-3 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP7 (CasΦ-2) | Guide targeting eGFP compatible with CasΦ-2 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP7 (CasΦ-3) | Guide targeting eGFP compatible with CasΦ-3 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP9 (CasΦ-3) | Guide targeting eGFP compatible with CasΦ-3 |
Show Experiments (1) |
|
| Model System | HEK-293-TgEF1a-eGFP-BSD | HEK293 cells with lentiviral insertion of EF1a promoter driving expression of eGFP and SV40 promoter driving expression of BSD. HEK293 is an epithelial-like cell that was isolated from the kidney of a patient. |
Show Experiments (1) |
|
| Guide | SapI-GG stuffer (CasΦ-2) | Non-targeting guide RNA targeting compatible with CasΦ-2 |
Show Experiments (1) |
|
| Vector | pPP394 | Plasmid containing Homo sapiens codon optimized CasΦ-1 and spacer for editing in human cells. | Addgene |
Show Experiments (1) |
| Experiment | Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells | Chemically modified crRNA and tracrRNA were delivered by electroporation to mouse Hepa 1-6 cells. Editing activity was determined by Sanger sequencing | ||
| Experiment | Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells | Chemically modified crRNA and tracrRNA were delivered by electroporation in presence of amphiphilic peptide to transgenic human HEK-293T cells harboring the TLR-MCV1 reporter. Gene editing was determined by reporter activation. | ||
| Model System | Neuro 2A | Neuro-2a cells are mouse neuroblasts with neuronal and amoeboid stem cell morphology isolated from brain tissue. | ATCC |
Show Experiments (1) |
| Genome Editor | SpyCas9-3xNLS | SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal | Sontheimer lab |
Show Experiments (5)
|
| Guide | STS120 (TLR1; Sp_t2:Sp_c20_TLR1) | Targets traffic light reporter transgene | In house production | |
| Guide | STS135 (PCSK9c; Sp_t2:Sp_c20_PCSK9c) | Targets endogenous mouse locus | In house production |
Show Experiments (1) |
| Guide | STS159 (mTmG; Sp_t2-PS:Sp_c0_mTmG) | This sgRNA targets the mTmG transgene | In house production | |
| Guide | STS204 (DNMT1; Sp_t41:Sp_c20_Dnmt1) | Targets endogenous mouse locus | In house production | |
| Genome Editor | CasΦ-3 | Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies | Jennifer Doudna Lab |
Show Experiments (1) |
| Guide | Cas12j-GFP10 (CasΦ-3) | Guide targeting eGFP compatible with CasΦ-3 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP11 (CasΦ-3) | Guide targeting eGFP compatible with CasΦ-3 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP4 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP5 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP8 (CasΦ-2) | Guide targeting eGFP compatible with CasΦ-2 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP9 (CasΦ-2) | Guide targeting eGFP compatible with CasΦ-2 |
Show Experiments (1) |
|
| Vector | pPP444 | Plasmid containing Homo sapiens codon optimized CasΦ-3 and spacer for editing in human cells. | Addgene |
Show Experiments (1) |
| Delivery System | FSD114d1 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (3)
|
| Delivery System | FSD195 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (3)
|
| Delivery System | FSD262 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (4)
|
| Delivery System | Lipofectamine 3000 | Lipid nanoparticle | Thermo Fisher Scientific | |
| Experiment | Testing newly discovered Biggie Phage editors in human cells | |||
| Guide | Cas12j-GFP15 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP17 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP2 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP3 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP3 (CasΦ-2) | Guide targeting eGFP compatible with CasΦ-2 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP5 (CasΦ-3) | Guide targeting eGFP compatible with CasΦ-3 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP6 (CasΦ-2) | Guide targeting eGFP compatible with CasΦ-2 |
Show Experiments (1) |
|
| Delivery System | FSD197 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (3)
|
| Delivery System | FSD238 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (3)
|
| Delivery System | FSD285 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (3)
|
| Delivery System | FSD315 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (7)
|
| Delivery System | FSD95 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (3)
|
| Genome Editor | CasΦ-1 | Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies | Jennifer Doudna Lab |
Show Experiments (1) |
| Guide | Cas12j-GFP14 (CasΦ-3) | Guide targeting eGFP compatible with CasΦ-3 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP18 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP5 (CasΦ-2) | Guide targeting eGFP compatible with CasΦ-2 |
Show Experiments (1) |
|
| Guide | SapI-GG stuffer (CasΦ-1) | Non-targeting guide RNA targeting compatible with CasΦ-1 |
Show Experiments (1) |
|
| Vector | pPP441 | Plasmid containing Homo sapiens codon optimized CasΦ-2 and spacer for editing in human cells. | Addgene |
Show Experiments (1) |
| Delivery System | FSD237 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (5)
|
| Delivery System | FSD321 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (4)
|
| Delivery System | FSD115d1 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (3)
|
| Model System | Primary Airway Epithelia (Human) | Primary airway epithelia from non-CF donors | University of Iowa |
Show Experiments (4)
|
| Genome Editor | SpCas9 (Feldan Therapeutics) | Feldan Therapeutics |
Show Experiments (4)
|
|
| Delivery System | FSD301 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (3)
|
| Delivery System | FSD63D1 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (3)
|
| Guide | Cas12j-GFP10 (CasΦ-2) | Guide targeting eGFP compatible with CasΦ-2 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP12 (CasΦ-3) | Guide targeting eGFP compatible with CasΦ-3 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP13 (CasΦ-3) | Guide targeting eGFP compatible with CasΦ-3 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP14 (CasΦ-2) | Guide targeting eGFP compatible with CasΦ-2 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP19 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP1 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP1 (CasΦ-2) | Guide targeting eGFP compatible with CasΦ-2 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP20 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP21 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP22 (CasΦ-1) | Guide targeting eGFP compatible with CasΦ-1 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP2 (CasΦ-2) | Guide targeting eGFP compatible with CasΦ-2 |
Show Experiments (1) |
|
| Guide | Cas12j-GFP8 (CasΦ-3) | Guide targeting eGFP compatible with CasΦ-3 |
Show Experiments (1) |
|
| Guide | SapI-GG stuffer (CasΦ-3) | Non-targeting guide RNA targeting compatible with CasΦ-3 |
Show Experiments (1) |
|
| Experiment | Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts | WT female mouse and homozygous male mouse containing the Gene Editing Reporter 14 (GER14) reporter at the Rosa26 locus were mated. Females were super-ovulated and zygotes harvested. Zyotes were electroporated with various CRISPR/Cas9 combinations (or Cre) and were cultured 96 hours to blastocyst stage. Blastocysts were imaged for Katushka2S (RFP) fluorescence and scored for fluorescence signal. Blastocysts were then PCR amplified for the reporter allele and Sanger sequenced. ICE analysis tool from Synthego was used to score edits. NOTE: Some blasts did not PCR amplify well and it could not be determined if they had edits. Total blasts analyzed expressing the fluorescent reporter, 46-164. Total blast analyzed by Sanger sequencing, 39-142. | ||
| Guide | STS159 (mTmG; Sp_t2:Sp_c20_mTmG) | This sgRNA targets the mTmG transgene | In house production |
Show Experiments (4)
|
| Experiment | Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control | Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles provided from the Gong Lab at the University of Wisconsin-Madison. The Gong lab conducted free radical polymerization of the monomer coating with (PEG)-acrylate to ensure that the RNP-NC be stable and able to conjugate different ligands. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The tri(GalNAc) is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP-NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. The goal was to investigate cellular uptake of Cas9-gRNA nanocapsules using imaging after 24 hours and to determine the appropriate ratio for Lipofectamine-RNP positive control. | ||
| Genome Editor | SpyCas9-3xNLS | SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal | Sontheimer lab |
Show Experiments (7)
|
| Publication | Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing. | Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attributes benchmarked against AAV serotype 9 as evidenced by robust reporter and therapeutic gene expression, Cre recombination and CRISPR genome editing in normal and diseased mouse models. Enhanced transduction efficiency of AAV.cc47 vectors is further corroborated in macaques and pigs, providing a strong rationale for potential clinical translation into human gene therapies. We envision that ccAAV vectors may not only improve predictive modeling in preclinical studies, but also clinical translatability by broadening the therapeutic window of AAV based gene therapies. | ||
| Genome Editor | SpCas9 | HA-SV40NLS-SpCas9-SV40NLS | Vector Encoded | |
| Antibody | RRID:AB_2536526 | GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362 |
Show Experiments (3)
|
|
| Guide | STS204 (DNMT1; Sp_t2:Sp_c20_Dnmt1) | For endogenous locus | In house production | |
| Experiment | Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system | Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The triGalNAc is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP-NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. Liver microtissue with a monoculture of primary human hepatocytes (PHH) was used. Each well of the liver-on-a-chip typically is seeded with 6.0 × 10^5 hepatocytes 16 hours prior to the addition of RNP-NCs with flow of 1.0 µl/s through the liver 3D microtissues. Lipofectamine – RNP complex was prepared using Lipofectamine 2000 Transfection Reagent with 1:1 weight to weight ratio after optimization of transfection efficiency. The goal of the experiment was to examine transfection efficiency by testing two doses 2.4 ug and 24 ug RNP-NCs [tri(GalNAc), TAT] with the help of imaging. Transfection of 24µg RNP-NC shows higher uptake when compared to2.4µg RNP-NC. | ||
| Experiment | Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system | Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The triGalNAc is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP- NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. Liver microtissue with a monoculture of primary human hepatocytes (PHH) was used. Each well of the liver-on-a-chip typically is seeded with 6.0 × 10^5 hepatocytes 16 hours prior to the addition of RNP-NCs with flow of 1.0 µl/s through the liver 3D microtissues. Lipofectamine – RNP complex was prepared using Lipofectamine 2000 Transfection Reagent with 1:1 weight to weight ratio after optimization of transfection efficiency. The goal of the experiment was to quantify transfection efficiency by testing two doses 2.4 ug and 24 ug RNP-NCs [tri(GalNAc), TAT] using flow cytometry. Transfection of 24µg RNP-NC shows higher uptake when compared to2.4µg RNP-NC. | ||
| Model System | mTmG mouse (congenic) | mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. | The Jackson Laboratory |
Show Experiments (7)
|
| Guide | Ai14 gRNA | This sgRNA targets the Ai9 and related transgenes at multiple sites | IDT |
Show Experiments (3)
|
| Genome Editor | sNLS-SpCas9-sNLS | SpCas9 with N- and C-terminal SV40 NLS | Aldevron 9212-5MG |
Show Experiments (6)
|
| Delivery System | RNP-NC-CPP | The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity | Gong Lab |
Show Experiments (6)
|
| Delivery System | RNP-NC-no ligand | The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. | Gong Lab |
Show Experiments (4)
|
| Model System | Ai9 mouse | Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. | The Jackson Laboratory |
Show Experiments (11)
|
| Genome Editor | Alt-R™ S.p. Cas9 Nuclease V3 | Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. | Integrated DNA Technologies (IDT) |
Show Experiments (10)
|