Search Result for CRISPR

Table View
List View

330 results for CRISPR

1. CRISPR-CasΦ from huge phages is a hypercompact genome editor. Publication - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems name : CRISPR-CasΦ from huge phages is a hypercompact genome editor. description : CRISPR-Cas systems are found widely in prokaryotes, where they provide adaptive immunity against virus We describe a minimal functional CRISPR-Cas system, comprising a single ~70-kilodalton protein, CasΦ, and a CRISPR array, encoded exclusively in the genomes of huge bacteriophages. CasΦ uses a single active site for both CRISPR RNA (crRNA) processing and crRNA-guided DNA cutting to vitro and in human and plant cells with expanded target recognition capabilities relative to other CRISPR-Cas Pausch P, Al-Shayeb B, Bisom-Rapp E, Tsuchida CA, Li Z, Cress BF, Knott GJ, Jacobsen SE, Banfield JF, Doudna JA PII: 369/6501/333, PUBMED 32675376, PMC PMC8207990, MID NIHMS1702779, DOI 10.1126/science.abb1400 ABSTRACT: CRISPR-Cas systems are found widely in prokaryotes, where they provide adaptive immunity against virus infection and plasmid transformation. We describe a minimal functional CRISPR-Cas system, comprising a single ~70-kilodalton protein, CasΦ, and a CRISPR array, encoded exclusively in the genomes of huge bacteriophages. CasΦ uses a single active site for both CRISPR RNA (crRNA) processing and crRNA-guided DNA cutting to target foreign nucleic acids. This hypercompact system is active in vitro an ... SCGE data tags... Projects Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Project [Delivery Systems] Matched Fields: name : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors description : RNA-guided CRISPR genome editing systems promise to revolutionize the treatment of inherited disease. that directs editing is a critical hurdle in the development of clinical applications for engineered CRISPR nucleic acid therapeutics, we have established a framework for complete chemical modification of CRISPR Sontheimer Erik J Last Updated Date: 2021-04-15 RNA-guided CRISPR genome editing systems promise to revolutionize the treatment of inherited disease. Safe, effective, and target-tissue-specific delivery of the guide RNA that directs editing is a critical hurdle in the development of clinical applications for engineered CRISPR systems. Using strategies validated for the delivery of other categories of nucleic acid therapeutics, we have established a framework for complete chemical modification of CRISPR guides, thereby conferring in vivo stability and effective biodistribution properties. The proposed research will optimize these guides, as well as other editing components, for clinical use. Show Experiments (11) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center
Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Project [Delivery Systems] Matched Fields: name : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides McCray Paul B Last Updated Date: 2020-11-02 The proposed research is relevant to the public health because genetic and acquired diseases affecting the airways pose major disease and economic burdens. By advancing the delivery of gene editing tools, it may be possible to therapeutically modify the cells lining the airways. This novel strategy has implications for the treatment of both monogenetic and acquired lungs disease, and may have applications for other somatic cell therapies. Show Experiments (6) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain Project [Delivery Systems] Matched Fields: name : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain description : In vivo genome editing using CRISPR/Cas9 is anticipated to be the next wave of therapeutics for various Gong Shaoqin (Sarah) Last Updated Date: 2020-10-28 In vivo genome editing using CRISPR/Cas9 is anticipated to be the next wave of therapeutics for various major health threats, including neurodegenerative diseases. However, to date, very few Cas9-gRNA ribonucleoprotein in vivo delivery methods have been reported, and delivery to the brain has been particularly challenging. The unique nanocapsules we plan to develop will ultimately enable high efficiency neuron-targeted genome editing in the brain, thereby offering new hope to treat devastating neurodegenerative diseases. Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Project [Delivery Systems] Matched Fields: name : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Gao Guang-Ping Last Updated Date: 2020-10-20 Efficacy and safety limitations in current gene editing technologies have hindered efforts to treat genetic lung diseases. This proposal seeks to develop and validate a combinatorial delivery approach that uses non-viral and viral vehicles to efficiently transport gene editing tools to disease-relevant cells in the lung. Completion of our work will establish safe and effective delivery vehicles that will guide the design of future gene therapies for genetic disorders. Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain name : Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. description : Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene experimentName : Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Gong Shaoqin (Sarah) Last Updated Date: 2020-10-28 Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression. Show Project Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
7. CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity. Publication - [In Vitro] [Biological Effects] [Human] Matched Fields: name : CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity. description : Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily Lazzarotto CR, Malinin NL, Li Y, Zhang R, Yang Y, Lee G, Cowley E, He Y, Lan X, Jividen K, Katta V, Kolmakova NG, Petersen CT, Qi Q, Strelcov E, Maragh S, Krenciute G, Ma J, Cheng Y, Tsai SQ PII: 10.1038/s41587-020-0555-7, PUBMED 32541958, PMC PMC7652380, MID NIHMS1591991, DOI 10.1038/s41587-020-0555-7 ABSTRACT: Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily scalable to the throughput needed to fully understand the principles that govern Cas9 specificity. Here we describe 'circularization for high-throughput analysis of nuclease genome-wide effects by sequencing' (CHANGE-seq), a scalable, automatable tagmentation-based method for measuring the genome-wide activity of Cas9 in vitro. We applied CHANGE-seq to 110 single guide RNA targets across 13 thera ... SCGE data tags... Projects A Novel Human T-Cell Platform to Define Biological Effects of Genome Editing
8. Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia. Publication - [In Vivo, In Vitro] [Delivery Systems] [Human, Mouse] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides name : Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway description : These shuttle peptides, non-covalently combined with GFP protein or CRISPR-associated nuclease (Cas) Krishnamurthy S, Wohlford-Lenane C, Kandimalla S, Sartre G, Meyerholz DK, Théberge V, Hallée S, Duperré AM, Del'Guidice T, Lepetit-Stoffaes JP, Barbeau X, Guay D, McCray PB PII: 10.1038/s41467-019-12922-y, PUBMED 31659165, PMC PMC6817825, DOI 10.1038/s41467-019-12922-y ABSTRACT: The delivery of biologic cargoes to airway epithelial cells is challenging due to the formidable barriers imposed by its specialized and differentiated cells. Among cargoes, recombinant proteins offer therapeutic promise but the lack of effective delivery methods limits their development. Here, we achieve protein and SpCas9 or AsCas12a ribonucleoprotein (RNP) delivery to cultured human well-differentiated airway epithelial cells and mouse lungs with engineered amphiphilic peptides. These shuttle ... SCGE data tags... Delivery System S10; Projects Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: name : Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear description : Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. experimentName : Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Murray Stephen A Last Updated Date: 2023-07-11 Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed. Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data)
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: name : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to description : Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Murray Stephen A Last Updated Date: 2023-05-10 Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice Show Project The Jackson Laboratory Gene Editing Testing Center - Gong Validation (Gong, Shaoqin)
[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: name : Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 description : Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice experimentName : Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Murray Stephen A Last Updated Date: 2023-05-10 Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice Show Project The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi)
[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: name : Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear description : Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice experimentName : Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Murray Stephen A Last Updated Date: 2023-05-10 Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice Show Project The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi)
Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Project [Genome Editors] Matched Fields: name : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems description : Expanding genome editing tools through exploration of new CRISPR-Cas proteins and DNA repair enzymes NARRATIVE Fundamental research on bacterial adaptive immunity uncovered the genome editing properties of CRISPR-Cas We will focus our investigation on newly described CRISPR-Cas systems and DNA-interacting proteins that Banfield Jillian , Doudna Jennifer A Last Updated Date: 2020-10-16 Expanding genome editing tools through exploration of new CRISPR-Cas proteins and DNA repair enzymes NARRATIVE Fundamental research on bacterial adaptive immunity uncovered the genome editing properties of CRISPR-Cas systems, and it is clear that uncultivated microbes contain more pathways and enzymes that may be useful as genome editing tools. We will combine bioinformatics and biochemistry to identify new DNA- and RNA-associating proteins and will analyze their mechanisms of action. We will focus our investigation on newly described CRISPR-Cas systems and DNA-interacting proteins that occur in conserved genomic context. Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: name : Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia description : Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung experimentName : Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Heaney Jason D Last Updated Date: 2021-09-07 Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - McCray Validation (McCray Jr., Paul)
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: name : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to description : Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Murray Stephen A Last Updated Date: 2023-07-18 Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed. Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Gong, Submission 2 (On- and Off-target data)
[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: name : Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 description : Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear experimentName : Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Murray Stephen A Last Updated Date: 2023-07-11 Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal. Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data)
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 experimentName : Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
[Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: name : Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR experimentName : Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR Murray Stephen A Last Updated Date: 2023-05-10 Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections. Show Project The Jackson Laboratory Gene Editing Testing Center - Sontheimer Validation (Sontheimer, Eric)
CleanCap® Cas9 mRNA (5moU) Genome Editor - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Ai14 gRNA Guide - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. This sgRNA targets the Ai9 and related transgenes at multiple sites Show Experiments (3) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: description : Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Heaney Jason D Last Updated Date: 2021-03-30 Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues. Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Asokan Validation (Asokan, Aravind)
AB_2532994 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Other Id: AB_2532994 13-0300 Thermo-Fisher, Rat anti-GFAP Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_10711040 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Other Id: RRID:AB_10711040 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RNP-NC-RVG Delivery System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry Show Experiments (2) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
AB_2813835 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Other Id: ab150155 AB_2813835 Abcam, Donkey anti-rat alexa fluour 647 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_2532994 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Other Id: RRID:AB_2532994 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
306-O12B Delivery System - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Combinatorial library cationic lipid nanoparticles Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
AAVcc47-Ai9-sgRNA2-CB-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAVcc47-Ai9-sgRNA1 + sgRNA2 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: description : Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing Heaney Jason D Last Updated Date: 2023-05-10 Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Deverman Validation (Deverman, Benjamin)
AAV9-Ai9-sgRNA1-CB-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAVcc47-Ai9-sgRNA1-CB-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
RNP-NC-no ligand Delivery System - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects, Animal Reporter and Testing Center] [Mouse] Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. Show Experiments (4) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Ai9 mouse Model System - [In Vivo] [Delivery Systems, AAV tropism, Animal Reporter and Testing Center] [Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Focused Ultrasound-mediated Delivery of Gene-editing Elements to the Brain for Neurodegenerative Disorders Project [Delivery Systems] Matched Fields: description : Current methodologies of delivering CRISPR-based gene editing elements to the brain are highly inefficient Leong Kam W Last Updated Date: 2022-04-15 Gene editing may offer a new therapeutic strategy to tackle many neurodegenerative disorders that remain untreatable. Current methodologies of delivering CRISPR-based gene editing elements to the brain are highly inefficient. We propose to develop a noninvasive, efficient approach to achieve gene editing in the brain using focused ultrasound technology. Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
306-S10 Delivery System - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear combinatorial library cationic lipid nanoparticles Show Experiments (5) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: description : AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal Heaney Jason D Last Updated Date: 2021-03-30 AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Gao Validation (Gao, Guang-Ping )
Podocyte-specific gene editing in human kidney organoids Experiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] Matched Fields: description : Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular Wilson Ross C. , Freedman Benjamin S Last Updated Date: 2024-01-16 Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter. Show Project Cas9 ribonucleoprotein delivery targeted to kidney epithelium
sNLS-SpCas9-sNLS Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects, Animal Reporter and Testing Center] [Mouse] Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. SpCas9 with N- and C-terminal SV40 NLS Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: description : Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were Heaney Jason D Last Updated Date: 2023-12-18 Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced. Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Chaikof Validation (Chaikof, Elliot L. )
STS159 (mTmG; Sp_t2:Sp_c20_mTmG) Guide - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors experimentName : Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR This sgRNA targets the mTmG transgene Show Experiments (4) Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
mTmG mouse (congenic) Model System - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors experimentName : Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. Show Experiments (7) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Ai14 mouse (congenic) Model System - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
sg298 Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
RRID:AB_2536526 Antibody - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors experimentName : Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR Other Id: Thermo Fisher Scientific Cat# G10362 RRID:AB_2536526 GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362 Show Experiments (3) Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Ai14 mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain experimentName : Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Ai9-SauSpyCas9 mouse Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: description : Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides McCray Paul B Last Updated Date: 2020-11-02 Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells. Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Experiment - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides McCray Paul B Last Updated Date: 2020-11-02 In Vitro shuttle peptide delivery of Cas12a RNP targeting human NKG2A gene in human NK cells. Gene editing was assessed after 48hr by T7E1 digestion. Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides McCray Paul B Last Updated Date: 2020-11-02 In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells. Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
FSD121 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD159 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD168 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD168D20 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (1) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells
FSD199 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD289 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD305 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD318 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD319 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD333 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD335 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD341 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD360 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD366 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD367 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD368 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD57d3 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD63 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD67 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD94 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSX6 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSX8 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
3849 45-5' Guide - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Targets endogenous human locus Show Experiments (1) Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
g-11_C9 Guide - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides sgRNA targeting CFTR exon 11 Show Experiments (1) Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
g-45_C12a Guide - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides gRNA targeting CFTR inton-22-23 Show Experiments (1) Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
sgAi9R Guide - [In Vivo, In Vitro] [Delivery Systems] [Human, Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases This sgRNA targets the Ai9 and related transgenes Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
HEK-293T with Ai9 transient reporter assay Model System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
NK Model System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Natural Killer cells. White blood cells; Show Experiments (1) Gene editing in vitro by various peptide variants delivering Cas12a in NK cells.
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Other Id: Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000 Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
D237 Delivery System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
AB_141637 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Other Id: AB_141637 A21207 Invitrogen, Donkey anti-rabbit alexa fluor 594 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Gao Guang-Ping Last Updated Date: 2021-09-21 AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types. Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
AsCas12a (IDT and Feldan Therapeutics) Genome Editor - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Cre recombinase Genome Editor - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Cre recombinase delivered by plasmid (see vector details) Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
FSD147 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD168d17 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD188 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD190 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD215 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD216 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD228 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD240 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD260 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD286 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD287 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD307 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD316 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD317 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD322 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD329 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD339 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD359 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD363 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD57d6 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD97 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSX4 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSX7 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
S10 Scr. Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
NKG2A Guide - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides gRNA targeting human NKG2A exon 3 Show Experiments (1) Gene editing in vitro by various peptide variants delivering Cas12a in NK cells.
Gong_Intracranial Injection Procedure for Mice Protocol - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain experimentName : Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Procedure for intracranial delivery to mouse brain. Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
S10 Delivery System - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Mouse, Rhesus macaque] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (12) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Sontheimer Erik J Last Updated Date: 2021-10-01 Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
STS159 (mTmG; Sp_t2-PS:Sp_c0_mTmG) Guide - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors This sgRNA targets the mTmG transgene Show Experiments (1) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain
RRID:AB_1196615 Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Other Id: AB_1196615 RRID:AB_1196615 GFP (D5.1) XP Rabbit mAb antibody, Cell Signaling Technology Show Experiments (3) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center
FSD117D1 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells
306-O12B blank Delivery System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Combinatorial library cationic lipid nanoparticles Show Experiments (2) Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Experiment - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Sontheimer Erik J Last Updated Date: 2021-04-15 Chemically modified crRNA and tracrRNA were delivered by electroporation to embryonic fibroblasts harvested from the mTmG reporter mouse. Gene editing was determined by reporter activation. Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells Experiment - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Sontheimer Erik J Last Updated Date: 2021-04-15 Chemically modified crRNA and tracrRNA were delivered by electroporation in presence of amphiphilic peptide to transgenic human HEK-293T cells harboring the TLR-MCV1 reporter. Gene editing was determined by reporter activation. Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
STS134 (PCSK9b; Sp_t2:Sp_c20_PCSK9b) Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Targets endogenous mouse locus Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells
STS135 (PCSK9c; Sp_t2:Sp_c20_PCSK9c) Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Targets endogenous mouse locus Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells
STS96 (PCSK9a; Sp_t2:Sp_c20_PCSK9a) Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Targets endogenous mouse locus Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells
Mouse Embryonic Fibroblasts Model System - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Primary cell line Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts
RRID:AB_2798820 Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Other Id: RRID:AB_2798820 AB_2798820 Cas9 (S. pyogenes) (E7M1H) XP® Rabbit mAb antibody, Cell Signaling Technology Show Experiments (1) Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain
D10 Delivery System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Heaney-SATC_McCray-Validation_Intranasal Instillation in Mice Protocol Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Procedure for intranasal instillation of ribonucleoprotein/peptide complex in mice for delivery to the lung. Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Murray-SATC_Gong-Validation Brain Injection in Mice Protocol Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Procedure for brain injection surgical procedure, pre- and post-operative care for mice. Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Murray-SATC_Gong-Validaiton_Gong Study Protocol Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Procedure for intracranial injection, immunofluorescence and imaging. Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
AB_10711040 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Other Id: AB_10711040 ab104224 Abcam, mouse anti-NeuN Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_141637 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Other Id: RRID:AB_141637 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_2813835 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Other Id: RRID:AB_2813835 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_141607 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Other Id: RRID:AB_141607 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
SpyCas9 g-loxP2_C9 Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia This sgRNA targets the mTmG transgene Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Heaney-SATC_McCray-Validation_Lung Inflation and Fixation Protocol Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Procedure for mouse lung inflation and fixation. Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
AB_2209751 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Other Id: Rockland Cat# 600-401-379 AB_2209751 Anti-RFP (RABBIT) Antibody Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
AB_141607 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Other Id: AB_141607 A21202 Invitrogen, Donkey anti-mouse alexafluor 488 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_2209751 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Other Id: RRID:AB_2209751 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts Experiment - [In Vitro] [Animal Reporter and Testing Center] Matched Fields: description : Zyotes were electroporated with various CRISPR/Cas9 combinations (or Cre) and were cultured 96 hours Murray Stephen A Last Updated Date: 2024-02-23 WT female mouse and homozygous male mouse containing the Gene Editing Reporter 14 (GER14) reporter at the Rosa26 locus were mated. Females were super-ovulated and zygotes harvested. Zyotes were electroporated with various CRISPR/Cas9 combinations (or Cre) and were cultured 96 hours to blastocyst stage. Blastocysts were imaged for Katushka2S (RFP) fluorescence and scored for fluorescence signal. Blastocysts were then PCR amplified for the reporter allele and Sanger sequenced. ICE analysis tool from Synthego was used to score edits. NOTE: Some blasts did not PCR amplify well and it could not be determined if they had edits. Total blasts analyzed expressing the fluorescent reporter, 46-164. Total blast analyzed by Sanger sequencing, 39-142. Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - GER14 small animal reporter, submission 1
Lipofectamine 3000 Delivery System - [In Vitro] [Delivery Systems, Genome Editors] [Human] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Lipid nanoparticle Show Experiments (2) Testing newly discovered Biggie Phage editors in human cells Testing AAV5 for activation of tdTomato in HEK293T cells
Testing AAV5 for activation of tdTomato in mouse airway Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Gao Guang-Ping Last Updated Date: 2020-10-20 AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
GFP-NLS Genome Editor - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Nuclear targeted GFP Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
FS66d6 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD115 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD122 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD160 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD168d10 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD168 Disul. Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD168 Scr. Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD191 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD196 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD227 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD236 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD291 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD304 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD306 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD323 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD361 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD362 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD364 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD57d1 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD57d4 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD57d5 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSX3 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
S18 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide Show Experiments (2) Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
pAAV.pU1a-SpCas9 Vector - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
pH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) Vector - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
g-loxP2_C9 Guide - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides This sgRNA targets the Ai9 and related transgenes Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
g-loxPbot_C12a Guide - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides This sgRNA targets the Ai9 and related transgenes at two sites Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
sgAi9L Guide - [In Vivo, In Vitro] [Delivery Systems] [Human, Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases This sgRNA targets the Ai9 and related transgenes Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
BALB/c mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Other Id: GFP (D5.1) XP Rabbit mAb antibody Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Other Id: Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200 Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
SaCas9-Lagor Genome Editor - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 Show Experiments (4) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. Experiment - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides McCray Paul B Last Updated Date: 2020-11-02 In Vitro shuttle peptide delivery of Cas12a RNPs targeting human CFTR and HPRT genes in human primary airway epithelia. Editing efficiency was assessed after 72hrs by sanger sequencing. Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
CM18-PTD4 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide Show Experiments (2) Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
FS48 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (1) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells
FSD114 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD116d1 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD118 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD132 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD189 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD193 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD222 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD259 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD284 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD293 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD297 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD303 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD308 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD310 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD334 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD365 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD96 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSX2 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSX5 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
S10D Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Other Id: Anti-RFP (RABBIT) Antibody Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Other Id: Anti-RFP (Rabbit) Polyclonal Antibody Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
202. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing. Publication - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: description : serotype 9 as evidenced by robust reporter and therapeutic gene expression, Cre recombination and CRISPR experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 Gonzalez TJ, Simon KE, Blondel LO, Fanous MM, Roger AL, Maysonet MS, Devlin GW, Smith TJ, Oh DK, Havlik LP, Castellanos Rivera RM, Piedrahita JA, ElMallah MK, Gersbach CA, Asokan A PII: 10.1038/s41467-022-33745-4, PUBMED 36210364, PMC PMC9548504, DOI 10.1038/s41467-022-33745-4 ABSTRACT: Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attrib ... SCGE data tags... Organisms: Mouse; Models: Ai9 mouse; Editors SaCas9-Lagor; Vectors AAV9-CMV-Cre; AAVcc47-CMV-Cre; AAV9-Ai9-sgRNA2-CB-SaCas9; AAVcc47-Ai9-sgRNA1-CB-SaCas9; AAVcc47-Ai9-sgRNA2-CB-SaCas9; AAV9-Ai9-sgRNA1-CB-SaCas9; AAV9-CMV-SaCas9; AAVcc47-Ai9-sgRNA1 + sgRNA2; AAVcc47-CMV-SaCas9; AAV9-Ai9-sgRNA1 + sgRNA2; AAVcc47_pTR_self comp 2xU6-Ai9 guides; AAV9_pTR_self comp 2xU6-Ai9 guides; Projects Evolving High Potency AAV Vectors for Neuromuscular Genome Editing Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
AAV9-Ai9-sgRNA1 + sgRNA2 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
AAV9-CMV-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 AAV serotype 9 delivering CMV driven SaCas9 Show Experiments (3) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
AAVcc47-CMV-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 AAVcc47 delivering CMV driven SaCas9 Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Sontheimer Erik J Last Updated Date: 2021-04-15 Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged. Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Sontheimer Erik J Last Updated Date: 2021-04-15 Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged. Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Sontheimer Erik J Last Updated Date: 2021-04-15 Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged. Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
STS118 (TLR-MCV1a; Sp_t2:Sp_c20_TLR_MCV1a) Guide - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Targets traffic light reporter transgene Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells
STS119 (TLR-MCV1b; Sp_t2:Sp_c20_TLR_MCV1b) Guide - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Targets traffic light reporter transgene Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells
STS120 (TLR1; Sp_t2:Sp_c20_TLR1) Guide - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Targets traffic light reporter transgene Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells
STS204 (DNMT1; Sp_t41:Sp_c20_Dnmt1) Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Targets endogenous mouse locus Show Experiments (2) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells
HEK-293T-disrupted_GFP-mcherry-Puro Model System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors HEK293T cells with an integrated reporter for TLR1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells
Neuro 2A Model System - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Neuro-2a cells are mouse neuroblasts with neuronal and amoeboid stem cell morphology isolated from brain tissue. Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells
Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Experiment - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Sontheimer Erik J Last Updated Date: 2021-04-15 Chemically modified crRNA and tracrRNA were delivered by electroporation to mouse Hepa 1-6 cells. Editing activity was determined by Sanger sequencing Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Sontheimer Erik J Last Updated Date: 2021-04-15 Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged. Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells Experiment - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Sontheimer Erik J Last Updated Date: 2021-04-15 Chemically modified crRNA and tracrRNA were delivered by electroporation to transgenic human HEK-293T cells harboring the TLR1 reporter. Gene editing was determined by reporter activation. Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells Experiment - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Sontheimer Erik J Last Updated Date: 2021-04-15 Chemically modified crRNA and tracrRNA were delivered by electroporation to mouse Neuro2A cells. Editing activity was determined by Sanger sequencing Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
SpyCas9-3xNLS Genome Editor - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal Show Experiments (5) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain
STS118 (TLR-MCV1a; Sp_t2-PS:Sp_c20_TLR_MCV1a) Guide - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Targets traffic light reporter transgene, CY3 labeled Show Experiments (1) Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain
STS205 (BACE1; Sp_t41:Sp_c20_Bace1) Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Targets endogenous mouse locus Show Experiments (2) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells
TLR-MCV1 mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors TLR-MCV1 transgene knocked into Rosa26 locus Show Experiments (1) Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain
CasΦ-2 Genome Editor - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP13 (CasΦ-3) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-3 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP14 (CasΦ-2) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-2 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP8 (CasΦ-3) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-3 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
HEK-293-TgEF1a-eGFP-BSD Model System - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems HEK293 cells with lentiviral insertion of EF1a promoter driving expression of eGFP and SV40 promoter driving expression of BSD. HEK293 is an epithelial-like cell that was isolated from the kidney of a patient. Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
RRID:AB_2313606 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR Other Id: Vector Labs Cat# BA-1000 RRID:AB_2313606 Vector Labs Goat Anti-Rabbit IgG Biotinylated Cat. #BA-1000 Show Experiments (1) Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
SpyCas9-3xNLS Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Human, Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors experimentName : Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal Show Experiments (7) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Cas12j-GFP10 (CasΦ-2) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-2 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP11 (CasΦ-3) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-3 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP15 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP17 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP22 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP3 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP3 (CasΦ-2) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-2 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP4 (CasΦ-2) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-2 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP5 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP8 (CasΦ-2) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-2 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP9 (CasΦ-2) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-2 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP9 (CasΦ-3) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-3 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
SapI-GG stuffer (CasΦ-3) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Non-targeting guide RNA targeting compatible with CasΦ-3 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Experiment - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides McCray Paul B Last Updated Date: 2020-11-02 Delivery of Cas9 RNP targeting human CFTR in Primary human epithelia cells. Gene editing efficiency was determined by percentage of NGS reads that showed an indel Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Experiment - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides McCray Paul B Last Updated Date: 2020-11-02 Delivery of Cas12a RNP targeting human CFTR in Primary human epithelia cells. Gene editing efficiency was determined by percentage of NGS reads that showed an indel Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Testing AAV5 for activation of tdTomato in HEK293T cells Experiment - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Gao Guang-Ping Last Updated Date: 2020-10-20 AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence. Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
AsCas12a (Feldan Therapeutics) Genome Editor - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Show Experiments (3) Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
FSD112 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD168 cyclic Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD168d11 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD168d12 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD168d20 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide Show Experiments (1) Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD186 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD234 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD235 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD239 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD283 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD288 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD330 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD331 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD332 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD347 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSD57 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
FSX1 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
S10-MOD Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
S85 Delivery System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide Show Experiments (2) Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
AAV.pU1a-SpCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
g-38330_C12a Guide - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides gRNA targeting HPRT locus Show Experiments (1) Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
McCray_CFTR_Cas9_Guide1 Guide - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Targets endogenous human locus Show Experiments (1) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells
mTmG mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Other Id: Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300 Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
SpCas9 (Feldan Therapeutics) Genome Editor - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Show Experiments (4) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells
FSD197 Delivery System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus
FSD262 Delivery System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Rhesus macaque] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (4) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus.
FSD315 Delivery System - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Rhesus macaque] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (7) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Primary Airway Epithelia (Human) Model System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Primary airway epithelia from non-CF donors Show Experiments (4) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus
FSD114d1 Delivery System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus
FSD115d1 Delivery System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus
FSD195 Delivery System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus
FSD237 Delivery System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Rhesus macaque] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (5) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus.
FSD321 Delivery System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Rhesus macaque] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (4) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus.
AAV9-Ai9-sgRNA2-CB-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Sontheimer Erik J Last Updated Date: 2021-04-15 Chemically modified crRNA and tracrRNA were injected into the striatum of TLR-MCV mice and the distribution of RNP was imaged. Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
STS159 (mTmG; Sp_t2-PS:Sp_c20_mTmG) Guide - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors This sgRNA targets the mTmG transgene Show Experiments (1) Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain
STS159 (mTmG; Sp_t2:Sp_c0_mTmG) Guide - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors This sgRNA targets the mTmG transgene Show Experiments (1) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain
HEK-293T-disrupted_GFP with MCV-mcherry-Puro Model System - [In Vitro] [Delivery Systems] [Human] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors HEK293T cells with an integrated reporter for TLR-MCV1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells
Hepa1-6 Model System - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Stable mouse cell line of liver epithelial cells. Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells
AAV9_pTR_self comp 2xU6-Ai9 guides Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Experiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] Matched Fields: description : Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles provided Wilson Ross C. , Kiani Samira , Gong Shaoqin (Sarah) Last Updated Date: 2023-12-18 Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles provided from the Gong Lab at the University of Wisconsin-Madison. The Gong lab conducted free radical polymerization of the monomer coating with (PEG)-acrylate to ensure that the RNP-NC be stable and able to conjugate different ligands. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The tri(GalNAc) is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP-NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. The goal was to investigate cellular uptake of Cas9-gRNA nanocapsules using imaging after 24 hours and to determine the appropriate ratio for Lipofectamine-RNP positive control. Show Project Comparing the efficiency and cellular impact of non-viral, hepatocyte-targeted delivery vehicles with viral-mediated gene delivery in a microphysiological liver on chip platform
Cas12j-GFP19 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP21 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
SapI-GG stuffer (CasΦ-2) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Non-targeting guide RNA targeting compatible with CasΦ-2 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
CasΦ-3 Genome Editor - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP10 (CasΦ-3) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-3 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP14 (CasΦ-3) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-3 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP16 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP20 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP2 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP4 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP5 (CasΦ-2) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-2 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP5 (CasΦ-3) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-3 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP6 (CasΦ-2) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-2 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP6 (CasΦ-3) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-3 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP7 (CasΦ-3) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-3 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
FSD285 Delivery System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus
FSD301 Delivery System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus
FSD95 Delivery System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Rhesus macaque] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus.
AAVcc47_pTR_self comp 2xU6-Ai9 guides Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
FSD63D1 Delivery System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Rhesus macaque] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus.
Testing newly discovered Biggie Phage editors in human cells Experiment - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Banfield Jillian , Doudna Jennifer A Last Updated Date: 2020-10-16 Show Project Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
CasΦ-1 Genome Editor - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
pPP394 Vector - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Plasmid containing Homo sapiens codon optimized CasΦ-1 and spacer for editing in human cells. Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
pPP441 Vector - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Plasmid containing Homo sapiens codon optimized CasΦ-2 and spacer for editing in human cells. Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
pPP444 Vector - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Plasmid containing Homo sapiens codon optimized CasΦ-3 and spacer for editing in human cells. Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP12 (CasΦ-3) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-3 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP18 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP1 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP1 (CasΦ-2) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-2 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP23 (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP2 (CasΦ-2) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-2 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Cas12j-GFP7 (CasΦ-2) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Guide targeting eGFP compatible with CasΦ-2 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
SapI-GG stuffer (CasΦ-1) Guide - [In Vitro] [Genome Editors] [Human] Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Non-targeting guide RNA targeting compatible with CasΦ-1 Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
SpCas9 Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Biological Effects] [Human, Mouse] Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases HA-SV40NLS-SpCas9-SV40NLS Show Experiments (4) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway A novel human T cell platform to define biological adverse effects of genome editing Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
SpCas9 Genome Editor - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Show Experiments (2) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
FSD238 Delivery System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus
STS204 (DNMT1; Sp_t2:Sp_c20_Dnmt1) Guide - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors experimentName : Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR For endogenous locus Show Experiments (2) Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
RNP-NC-CPP Delivery System - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects, Animal Reporter and Testing Center] [Mouse] Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Experiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] Matched Fields: description : Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles. Wilson Ross C. , Kiani Samira , Gong Shaoqin (Sarah) Last Updated Date: 2023-12-18 Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The triGalNAc is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP-NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. Liver microtissue with a monoculture of primary human hepatocytes (PHH) was used. Each well of the liver-on-a-chip typically is seeded with 6.0 × 10^5 hepatocytes 16 hours prior to the addition of RNP-NCs with flow of 1.0 µl/s through the liver 3D microtissues. Lipofectamine – RNP complex was prepared using Lipofectamine 2000 Transfection Reagent with 1:1 weight to weight ratio after optimization of transfection efficiency. The goal of the experiment was to examine transfection efficiency by testing two doses 2.4 ug and 24 ug RNP-NCs [tri(GalNAc), TAT] with the help of imaging. Transfection of 24µg RNP-NC shows higher uptake when compared to2.4µg RNP-NC. Show Project Comparing the efficiency and cellular impact of non-viral, hepatocyte-targeted delivery vehicles with viral-mediated gene delivery in a microphysiological liver on chip platform
Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system Experiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] Matched Fields: description : Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles. Wilson Ross C. , Kiani Samira , Gong Shaoqin (Sarah) Last Updated Date: 2023-12-18 Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The triGalNAc is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP- NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. Liver microtissue with a monoculture of primary human hepatocytes (PHH) was used. Each well of the liver-on-a-chip typically is seeded with 6.0 × 10^5 hepatocytes 16 hours prior to the addition of RNP-NCs with flow of 1.0 µl/s through the liver 3D microtissues. Lipofectamine – RNP complex was prepared using Lipofectamine 2000 Transfection Reagent with 1:1 weight to weight ratio after optimization of transfection efficiency. The goal of the experiment was to quantify transfection efficiency by testing two doses 2.4 ug and 24 ug RNP-NCs [tri(GalNAc), TAT] using flow cytometry. Transfection of 24µg RNP-NC shows higher uptake when compared to2.4µg RNP-NC. Show Project Comparing the efficiency and cellular impact of non-viral, hepatocyte-targeted delivery vehicles with viral-mediated gene delivery in a microphysiological liver on chip platform
Heaney_SATC Tissue Processing, Imaging and Analysis Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Procedure for tissue preparation, imaging and analysis. Show Experiments (4) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Alt-R® S.p. Cas9 Nuclease V3 Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. Show Experiments (10) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Validating Gene Editing Reporter 12 (GER12) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for NHEJ in Heterozygous Blastocysts Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 18 (GER18) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 19 (GER19) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for HDR in Heterozygous Blastocysts Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Homozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing

330 results for CRISPR

Category	Name	Description	Source	View Associated...
Publication	CRISPR-CasΦ from huge phages is a hypercompact genome editor.	CRISPR-Cas systems are found widely in prokaryotes, where they provide adaptive immunity against virus infection and plasmid transformation. We describe a minimal functional CRISPR-Cas system, comprising a single ~70-kilodalton protein, CasΦ, and a CRISPR array, encoded exclusively in the genomes of huge bacteriophages. CasΦ uses a single active site for both CRISPR RNA (crRNA) processing and crRNA-guided DNA cutting to target foreign nucleic acids. This hypercompact system is active in vitro and in human and plant cells with expanded target recognition capabilities relative to other CRISPR-Cas proteins. Useful for genome editing and DNA detection but with a molecular weight half that of Cas9 and Cas12a genome-editing enzymes, CasΦ offers advantages for cellular delivery that expand the genome editing toolbox.
Project	Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors	RNA-guided CRISPR genome editing systems promise to revolutionize the treatment of inherited disease. Safe, effective, and target-tissue-specific delivery of the guide RNA that directs editing is a critical hurdle in the development of clinical applications for engineered CRISPR systems. Using strategies validated for the delivery of other categories of nucleic acid therapeutics, we have established a framework for complete chemical modification of CRISPR guides, thereby conferring in vivo stability and effective biodistribution properties. The proposed research will optimize these guides, as well as other editing components, for clinical use.		Show Experiments (11) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center
Project	Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides	The proposed research is relevant to the public health because genetic and acquired diseases affecting the airways pose major disease and economic burdens. By advancing the delivery of gene editing tools, it may be possible to therapeutically modify the cells lining the airways. This novel strategy has implications for the treatment of both monogenetic and acquired lungs disease, and may have applications for other somatic cell therapies.		Show Experiments (6) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
Project	Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain	In vivo genome editing using CRISPR/Cas9 is anticipated to be the next wave of therapeutics for various major health threats, including neurodegenerative diseases. However, to date, very few Cas9-gRNA ribonucleoprotein in vivo delivery methods have been reported, and delivery to the brain has been particularly challenging. The unique nanocapsules we plan to develop will ultimately enable high efficiency neuron-targeted genome editing in the brain, thereby offering new hope to treat devastating neurodegenerative diseases.		Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Project	Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases	Efficacy and safety limitations in current gene editing technologies have hindered efforts to treat genetic lung diseases. This proposal seeks to develop and validate a combinatorial delivery approach that uses non-viral and viral vehicles to efficiently transport gene editing tools to disease-relevant cells in the lung. Completion of our work will establish safe and effective delivery vehicles that will guide the design of future gene therapies for genetic disorders.		Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Experiment	Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.	Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression.		Show Project Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
Publication	CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity.	Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily scalable to the throughput needed to fully understand the principles that govern Cas9 specificity. Here we describe 'circularization for high-throughput analysis of nuclease genome-wide effects by sequencing' (CHANGE-seq), a scalable, automatable tagmentation-based method for measuring the genome-wide activity of Cas9 in vitro. We applied CHANGE-seq to 110 single guide RNA targets across 13 therapeutically relevant loci in human primary T cells and identified 201,934 off-target sites, enabling the training of a machine learning model to predict off-target activity. Comparing matched genome-wide off-target, chromatin modification and accessibility, and transcriptional data, we found that cellular off-target activity was two to four times more likely to occur near active promoters, enhancers and transcribed regions. Finally, CHANGE-seq analysis of six targets across eight individual genomes revealed that human single-nucleotide variation had significant effects on activity at ~15.2% of off-target sites analyzed. CHANGE-seq is a simplified, sensitive and scalable approach to understanding the specificity of genome editors.
Publication	Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia.	The delivery of biologic cargoes to airway epithelial cells is challenging due to the formidable barriers imposed by its specialized and differentiated cells. Among cargoes, recombinant proteins offer therapeutic promise but the lack of effective delivery methods limits their development. Here, we achieve protein and SpCas9 or AsCas12a ribonucleoprotein (RNP) delivery to cultured human well-differentiated airway epithelial cells and mouse lungs with engineered amphiphilic peptides. These shuttle peptides, non-covalently combined with GFP protein or CRISPR-associated nuclease (Cas) RNP, allow rapid entry into cultured human ciliated and non-ciliated epithelial cells and mouse airway epithelia. Instillation of shuttle peptides combined with SpCas9 or AsCas12a RNP achieves editing of loxP sites in airway epithelia of ROSAmT/mG mice. We observe no evidence of short-term toxicity with a widespread distribution restricted to the respiratory tract. This peptide-based technology advances potential therapeutic avenues for protein and Cas RNP delivery to refractory airway epithelial cells.
Experiment	[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear	Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed.		Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data)
Experiment	[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain	Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice		Show Project The Jackson Laboratory Gene Editing Testing Center - Gong Validation (Gong, Shaoqin)
Experiment	[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear	Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice		Show Project The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi)
Experiment	[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear	Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice		Show Project The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi)
Project	Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems	Expanding genome editing tools through exploration of new CRISPR-Cas proteins and DNA repair enzymes NARRATIVE Fundamental research on bacterial adaptive immunity uncovered the genome editing properties of CRISPR-Cas systems, and it is clear that uncultivated microbes contain more pathways and enzymes that may be useful as genome editing tools. We will combine bioinformatics and biochemistry to identify new DNA- and RNA-associating proteins and will analyze their mechanisms of action. We will focus our investigation on newly described CRISPR-Cas systems and DNA-interacting proteins that occur in conserved genomic context.		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Experiment	[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides	Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - McCray Validation (McCray Jr., Paul)
Experiment	[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain	Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed.		Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Gong, Submission 2 (On- and Off-target data)
Experiment	[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear	Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal.		Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data)
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)	A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.	A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)	A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Experiment	Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)	A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Experiment	[Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain	Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections.		Show Project The Jackson Laboratory Gene Editing Testing Center - Sontheimer Validation (Sontheimer, Eric)
Genome Editor	CleanCap® Cas9 mRNA (5moU)	SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA.	Trilink Biotechnologies	Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Guide	Ai14 gRNA	This sgRNA targets the Ai9 and related transgenes at multiple sites	IDT	Show Experiments (3) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Experiment	[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.	Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Asokan Validation (Asokan, Aravind)
Antibody	AB_2532994	Thermo-Fisher, Rat anti-GFAP		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_10711040			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Delivery System	RNP-NC-RVG	The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry	Gong Lab	Show Experiments (2) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	AB_2813835	Abcam, Donkey anti-rat alexa fluour 647		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_2532994			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Delivery System	306-O12B	Combinatorial library cationic lipid nanoparticles	Xu lab	Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Vector	AAVcc47-Ai9-sgRNA2-CB-SaCas9	AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAVcc47-Ai9-sgRNA1 + sgRNA2	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Experiment	[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain	Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Deverman Validation (Deverman, Benjamin)
Vector	AAV9-Ai9-sgRNA1-CB-SaCas9	AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAVcc47-Ai9-sgRNA1-CB-SaCas9	AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Delivery System	RNP-NC-no ligand	The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA.	Gong Lab	Show Experiments (4) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Model System	Ai9 mouse	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	The Jackson Laboratory	Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Project	Focused Ultrasound-mediated Delivery of Gene-editing Elements to the Brain for Neurodegenerative Disorders	Gene editing may offer a new therapeutic strategy to tackle many neurodegenerative disorders that remain untreatable. Current methodologies of delivering CRISPR-based gene editing elements to the brain are highly inefficient. We propose to develop a noninvasive, efficient approach to achieve gene editing in the brain using focused ultrasound technology.		Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Delivery System	306-S10	combinatorial library cationic lipid nanoparticles	Xu lab	Show Experiments (5) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Experiment	[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice	AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Gao Validation (Gao, Guang-Ping )
Experiment	Podocyte-specific gene editing in human kidney organoids	Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter.		Show Project Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Genome Editor	sNLS-SpCas9-sNLS	SpCas9 with N- and C-terminal SV40 NLS	Aldevron 9212-5MG	Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Experiment	[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver	Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced.		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Chaikof Validation (Chaikof, Elliot L. )
Guide	STS159 (mTmG; Sp_t2:Sp_c20_mTmG)	This sgRNA targets the mTmG transgene	in house production	Show Experiments (4) Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Model System	mTmG mouse (congenic)	mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed.	The Jackson Laboratory	Show Experiments (7) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Model System	Ai14 mouse (congenic)	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Guide	sg298	This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases	Synthego	Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Antibody	RRID:AB_2536526	GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362		Show Experiments (3) Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Model System	Ai14 mouse	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Model System	Ai9-SauSpyCas9 mouse	Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.	Baylor College of Medicine	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Experiment	Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.	Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells.		Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Experiment	Gene editing in vitro by various peptide variants delivering Cas12a in NK cells.	In Vitro shuttle peptide delivery of Cas12a RNP targeting human NKG2A gene in human NK cells. Gene editing was assessed after 48hr by T7E1 digestion.		Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Experiment	Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia	In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells.		Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Delivery System	FSD121	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD159	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD168	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD168D20	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (1) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells
Delivery System	FSD199	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD289	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD305	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD318	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD319	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD333	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD335	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD341	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD360	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD366	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD367	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD368	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD57d3	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD63	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD67	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD94	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSX6	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSX8	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Guide	3849 45-5'	Targets endogenous human locus	IDT	Show Experiments (1) Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Guide	g-11_C9	sgRNA targeting CFTR exon 11	IDT	Show Experiments (1) Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
Guide	g-45_C12a	gRNA targeting CFTR inton-22-23	IDT	Show Experiments (1) Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
Guide	sgAi9R	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Model System	HEK-293T with Ai9 transient reporter assay	HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.		Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Model System	NK	Natural Killer cells. White blood cells;	GreenCross LabCell	Show Experiments (1) Gene editing in vitro by various peptide variants delivering Cas12a in NK cells.
Antibody		Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Delivery System	D237		McCray Lab	Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Antibody	AB_141637	Invitrogen, Donkey anti-rabbit alexa fluor 594		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Experiment	Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells	AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.		Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Genome Editor	AsCas12a (IDT and Feldan Therapeutics)		IDT and Feldan Therapeutics	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Genome Editor	Cre recombinase	Cre recombinase delivered by plasmid (see vector details)		Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Delivery System	FSD147	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD168d17	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD188	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD190	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD215	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD216	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD228	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD240	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD260	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD286	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD287	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD307	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD316	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD317	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD322	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD329	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD339	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD359	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD363	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD57d6	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD97	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSX4	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSX7	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	S10 Scr.	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Guide	NKG2A	gRNA targeting human NKG2A exon 3	IDT	Show Experiments (1) Gene editing in vitro by various peptide variants delivering Cas12a in NK cells.
Protocol	Gong_Intracranial Injection Procedure for Mice	Procedure for intracranial delivery to mouse brain.		Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Delivery System	S10	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (12) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Experiment	Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center	Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain		Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Guide	STS159 (mTmG; Sp_t2-PS:Sp_c0_mTmG)	This sgRNA targets the mTmG transgene	in house production	Show Experiments (1) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain
Antibody	RRID:AB_1196615	GFP (D5.1) XP Rabbit mAb antibody, Cell Signaling Technology		Show Experiments (3) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center
Delivery System	FSD117D1	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells
Delivery System	306-O12B blank	Combinatorial library cationic lipid nanoparticles	Xu lab	Show Experiments (2) Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Experiment	Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts	Chemically modified crRNA and tracrRNA were delivered by electroporation to embryonic fibroblasts harvested from the mTmG reporter mouse. Gene editing was determined by reporter activation.		Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Experiment	Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells	Chemically modified crRNA and tracrRNA were delivered by electroporation in presence of amphiphilic peptide to transgenic human HEK-293T cells harboring the TLR-MCV1 reporter. Gene editing was determined by reporter activation.		Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Guide	STS134 (PCSK9b; Sp_t2:Sp_c20_PCSK9b)	Targets endogenous mouse locus	in house production	Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells
Guide	STS135 (PCSK9c; Sp_t2:Sp_c20_PCSK9c)	Targets endogenous mouse locus	in house production	Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells
Guide	STS96 (PCSK9a; Sp_t2:Sp_c20_PCSK9a)	Targets endogenous mouse locus	in house production	Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells
Model System	Mouse Embryonic Fibroblasts	Primary cell line	In-house: https://jacks-lab.mit.edu/protocols/making_mefs	Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts
Antibody	RRID:AB_2798820	Cas9 (S. pyogenes) (E7M1H) XP® Rabbit mAb antibody, Cell Signaling Technology		Show Experiments (1) Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain
Delivery System	D10		McCray Lab	Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Protocol	Heaney-SATC_McCray-Validation_Intranasal Instillation in Mice Protocol	Procedure for intranasal instillation of ribonucleoprotein/peptide complex in mice for delivery to the lung.		Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Protocol	Murray-SATC_Gong-Validation Brain Injection in Mice Protocol	Procedure for brain injection surgical procedure, pre- and post-operative care for mice.		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Protocol	Murray-SATC_Gong-Validaiton_Gong Study Protocol	Procedure for intracranial injection, immunofluorescence and imaging.		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	AB_10711040	Abcam, mouse anti-NeuN		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_141637			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_2813835			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_141607			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Guide	SpyCas9 g-loxP2_C9	This sgRNA targets the mTmG transgene	IDT	Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Protocol	Heaney-SATC_McCray-Validation_Lung Inflation and Fixation Protocol	Procedure for mouse lung inflation and fixation.		Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Antibody	AB_2209751	Anti-RFP (RABBIT) Antibody		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	AB_141607	Invitrogen, Donkey anti-mouse alexafluor 488		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_2209751			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Experiment	Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts	WT female mouse and homozygous male mouse containing the Gene Editing Reporter 14 (GER14) reporter at the Rosa26 locus were mated. Females were super-ovulated and zygotes harvested. Zyotes were electroporated with various CRISPR/Cas9 combinations (or Cre) and were cultured 96 hours to blastocyst stage. Blastocysts were imaged for Katushka2S (RFP) fluorescence and scored for fluorescence signal. Blastocysts were then PCR amplified for the reporter allele and Sanger sequenced. ICE analysis tool from Synthego was used to score edits. NOTE: Some blasts did not PCR amplify well and it could not be determined if they had edits. Total blasts analyzed expressing the fluorescent reporter, 46-164. Total blast analyzed by Sanger sequencing, 39-142.		Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - GER14 small animal reporter, submission 1
Delivery System	Lipofectamine 3000	Lipid nanoparticle	Thermo Fisher Scientific	Show Experiments (2) Testing newly discovered Biggie Phage editors in human cells Testing AAV5 for activation of tdTomato in HEK293T cells
Experiment	Testing AAV5 for activation of tdTomato in mouse airway	AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation		Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Genome Editor	GFP-NLS	Nuclear targeted GFP	Expressed From (Escherichia coli BL21DE3)	Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
Delivery System	FS66d6	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD115	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD122	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD160	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD168d10	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD168 Disul.	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD168 Scr.	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD191	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD196	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD227	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD236	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD291	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD304	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD306	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD323	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD361	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD362	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD364	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD57d1	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD57d4	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD57d5	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSX3	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	S18	Shuttle peptide	Feldan Therapeutics (synthetic peptide from GL Biochem, 95% purity)	Show Experiments (2) Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
Vector	H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)	AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP	Addgene Gao Lab	Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Vector	pAAV.pU1a-SpCas9	Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS	Addgene Gao Lab	Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Vector	pH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)	AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP	Addgene Gao Lab	Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Guide	g-loxP2_C9	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Guide	g-loxPbot_C12a	This sgRNA targets the Ai9 and related transgenes at two sites	IDT	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Guide	sgAi9L	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Model System	BALB/c mouse	BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO).	The Jackson Laboratory	Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
Antibody		GFP (D5.1) XP Rabbit mAb antibody		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
Antibody		Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Genome Editor	SaCas9-Lagor		William Lagor, Baylor College Of Medicine	Show Experiments (4) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Experiment	Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.	In Vitro shuttle peptide delivery of Cas12a RNPs targeting human CFTR and HPRT genes in human primary airway epithelia. Editing efficiency was assessed after 72hrs by sanger sequencing.		Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Delivery System	CM18-PTD4	Shuttle peptide	Feldan Therapeutics (synthetic peptide from GL Biochem, 95% purity)	Show Experiments (2) Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
Delivery System	FS48	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (1) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells
Delivery System	FSD114	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD116d1	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD118	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD132	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD189	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD193	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD222	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD259	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD284	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD293	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD297	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD303	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD308	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD310	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD334	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD365	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD96	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSX2	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSX5	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	S10D	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Antibody		Anti-RFP (RABBIT) Antibody		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
Antibody		Anti-RFP (Rabbit) Polyclonal Antibody		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Publication	Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing.	Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attributes benchmarked against AAV serotype 9 as evidenced by robust reporter and therapeutic gene expression, Cre recombination and CRISPR genome editing in normal and diseased mouse models. Enhanced transduction efficiency of AAV.cc47 vectors is further corroborated in macaques and pigs, providing a strong rationale for potential clinical translation into human gene therapies. We envision that ccAAV vectors may not only improve predictive modeling in preclinical studies, but also clinical translatability by broadening the therapeutic window of AAV based gene therapies.
Vector	AAV9-Ai9-sgRNA1 + sgRNA2	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Vector	AAV9-CMV-SaCas9	AAV serotype 9 delivering CMV driven SaCas9	Asokan Lab	Show Experiments (3) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Vector	AAVcc47-CMV-SaCas9	AAVcc47 delivering CMV driven SaCas9	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Experiment	Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain	Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged.		Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Experiment	Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain	Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged.		Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Experiment	Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain	Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged.		Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Guide	STS118 (TLR-MCV1a; Sp_t2:Sp_c20_TLR_MCV1a)	Targets traffic light reporter transgene	in house production	Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells
Guide	STS119 (TLR-MCV1b; Sp_t2:Sp_c20_TLR_MCV1b)	Targets traffic light reporter transgene	in house production	Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells
Guide	STS120 (TLR1; Sp_t2:Sp_c20_TLR1)	Targets traffic light reporter transgene	in house production	Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells
Guide	STS204 (DNMT1; Sp_t41:Sp_c20_Dnmt1)	Targets endogenous mouse locus	in house production	Show Experiments (2) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells
Model System	HEK-293T-disrupted_GFP-mcherry-Puro	HEK293T cells with an integrated reporter for TLR1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.		Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells
Model System	Neuro 2A	Neuro-2a cells are mouse neuroblasts with neuronal and amoeboid stem cell morphology isolated from brain tissue.	ATCC	Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells
Experiment	Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells	Chemically modified crRNA and tracrRNA were delivered by electroporation to mouse Hepa 1-6 cells. Editing activity was determined by Sanger sequencing		Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Experiment	Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain	Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged.		Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Experiment	Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells	Chemically modified crRNA and tracrRNA were delivered by electroporation to transgenic human HEK-293T cells harboring the TLR1 reporter. Gene editing was determined by reporter activation.		Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Experiment	Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells	Chemically modified crRNA and tracrRNA were delivered by electroporation to mouse Neuro2A cells. Editing activity was determined by Sanger sequencing		Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Genome Editor	SpyCas9-3xNLS	SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal	Sontheimer lab	Show Experiments (5) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain
Guide	STS118 (TLR-MCV1a; Sp_t2-PS:Sp_c20_TLR_MCV1a)	Targets traffic light reporter transgene, CY3 labeled	in house production	Show Experiments (1) Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain
Guide	STS205 (BACE1; Sp_t41:Sp_c20_Bace1)	Targets endogenous mouse locus	in house production	Show Experiments (2) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells
Model System	TLR-MCV1 mouse	TLR-MCV1 transgene knocked into Rosa26 locus		Show Experiments (1) Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain
Genome Editor	CasΦ-2	Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies	Jennifer Doudna Lab	Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP13 (CasΦ-3)	Guide targeting eGFP compatible with CasΦ-3		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP14 (CasΦ-2)	Guide targeting eGFP compatible with CasΦ-2		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP8 (CasΦ-3)	Guide targeting eGFP compatible with CasΦ-3		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Model System	HEK-293-TgEF1a-eGFP-BSD	HEK293 cells with lentiviral insertion of EF1a promoter driving expression of eGFP and SV40 promoter driving expression of BSD. HEK293 is an epithelial-like cell that was isolated from the kidney of a patient.		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Antibody	RRID:AB_2313606	Vector Labs Goat Anti-Rabbit IgG Biotinylated Cat. #BA-1000		Show Experiments (1) Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Genome Editor	SpyCas9-3xNLS	SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal	Sontheimer lab	Show Experiments (7) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Guide	Cas12j-GFP10 (CasΦ-2)	Guide targeting eGFP compatible with CasΦ-2		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP11 (CasΦ-3)	Guide targeting eGFP compatible with CasΦ-3		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP15 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP17 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP22 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP3 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP3 (CasΦ-2)	Guide targeting eGFP compatible with CasΦ-2		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP4 (CasΦ-2)	Guide targeting eGFP compatible with CasΦ-2		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP5 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP8 (CasΦ-2)	Guide targeting eGFP compatible with CasΦ-2		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP9 (CasΦ-2)	Guide targeting eGFP compatible with CasΦ-2		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP9 (CasΦ-3)	Guide targeting eGFP compatible with CasΦ-3		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	SapI-GG stuffer (CasΦ-3)	Non-targeting guide RNA targeting compatible with CasΦ-3		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Experiment	Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells	Delivery of Cas9 RNP targeting human CFTR in Primary human epithelia cells. Gene editing efficiency was determined by percentage of NGS reads that showed an indel		Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Experiment	Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells	Delivery of Cas12a RNP targeting human CFTR in Primary human epithelia cells. Gene editing efficiency was determined by percentage of NGS reads that showed an indel		Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Experiment	Testing AAV5 for activation of tdTomato in HEK293T cells	AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence.		Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Genome Editor	AsCas12a (Feldan Therapeutics)		Feldan Therapeutics	Show Experiments (3) Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
Delivery System	FSD112	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD168 cyclic	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD168d11	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD168d12	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD168d20	Shuttle peptide	Feldan Therapeutics (synthetic peptide from GL Biochem, 95% purity)	Show Experiments (1) Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD186	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD234	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD235	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD239	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD283	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD288	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD330	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD331	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD332	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD347	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSD57	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	FSX1	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	S10-MOD	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (2) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells
Delivery System	S85	Shuttle peptide	Feldan Therapeutics (synthetic peptide from GL Biochem, 95% purity)	Show Experiments (2) Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
Vector	AAV.pU1a-SpCas9	Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS	Addgene Gao Lab	Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Guide	g-38330_C12a	gRNA targeting HPRT locus	IDT	Show Experiments (1) Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
Guide	McCray_CFTR_Cas9_Guide1	Targets endogenous human locus	IDT	Show Experiments (1) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells
Model System	mTmG mouse	ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence	The Jackson Laboratory	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Antibody		Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Genome Editor	SpCas9 (Feldan Therapeutics)		Feldan Therapeutics	Show Experiments (4) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells
Delivery System	FSD197	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus
Delivery System	FSD262	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (4) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus.
Delivery System	FSD315	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (7) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Model System	Primary Airway Epithelia (Human)	Primary airway epithelia from non-CF donors	University of Iowa	Show Experiments (4) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus
Delivery System	FSD114d1	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus
Delivery System	FSD115d1	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus
Delivery System	FSD195	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus
Delivery System	FSD237	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (5) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus.
Delivery System	FSD321	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (4) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus.
Vector	AAV9-Ai9-sgRNA2-CB-SaCas9	AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Experiment	Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain	Chemically modified crRNA and tracrRNA were injected into the striatum of TLR-MCV mice and the distribution of RNP was imaged.		Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Guide	STS159 (mTmG; Sp_t2-PS:Sp_c20_mTmG)	This sgRNA targets the mTmG transgene	in house production	Show Experiments (1) Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain
Guide	STS159 (mTmG; Sp_t2:Sp_c0_mTmG)	This sgRNA targets the mTmG transgene	in house production	Show Experiments (1) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain
Model System	HEK-293T-disrupted_GFP with MCV-mcherry-Puro	HEK293T cells with an integrated reporter for TLR-MCV1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.		Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells
Model System	Hepa1-6	Stable mouse cell line of liver epithelial cells.	ATCC	Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells
Vector	AAV9_pTR_self comp 2xU6-Ai9 guides	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Experiment	Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control	Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles provided from the Gong Lab at the University of Wisconsin-Madison. The Gong lab conducted free radical polymerization of the monomer coating with (PEG)-acrylate to ensure that the RNP-NC be stable and able to conjugate different ligands. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The tri(GalNAc) is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP-NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. The goal was to investigate cellular uptake of Cas9-gRNA nanocapsules using imaging after 24 hours and to determine the appropriate ratio for Lipofectamine-RNP positive control.		Show Project Comparing the efficiency and cellular impact of non-viral, hepatocyte-targeted delivery vehicles with viral-mediated gene delivery in a microphysiological liver on chip platform
Guide	Cas12j-GFP19 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP21 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	SapI-GG stuffer (CasΦ-2)	Non-targeting guide RNA targeting compatible with CasΦ-2		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Genome Editor	CasΦ-3	Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies	Jennifer Doudna Lab	Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP10 (CasΦ-3)	Guide targeting eGFP compatible with CasΦ-3		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP14 (CasΦ-3)	Guide targeting eGFP compatible with CasΦ-3		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP16 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP20 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP2 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP4 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP5 (CasΦ-2)	Guide targeting eGFP compatible with CasΦ-2		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP5 (CasΦ-3)	Guide targeting eGFP compatible with CasΦ-3		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP6 (CasΦ-2)	Guide targeting eGFP compatible with CasΦ-2		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP6 (CasΦ-3)	Guide targeting eGFP compatible with CasΦ-3		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP7 (CasΦ-3)	Guide targeting eGFP compatible with CasΦ-3		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Delivery System	FSD285	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus
Delivery System	FSD301	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus
Delivery System	FSD95	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus.
Vector	AAVcc47_pTR_self comp 2xU6-Ai9 guides	AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Delivery System	FSD63D1	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus.
Experiment	Testing newly discovered Biggie Phage editors in human cells			Show Project Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Genome Editor	CasΦ-1	Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies	Jennifer Doudna Lab	Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Vector	pPP394	Plasmid containing Homo sapiens codon optimized CasΦ-1 and spacer for editing in human cells.	Addgene	Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Vector	pPP441	Plasmid containing Homo sapiens codon optimized CasΦ-2 and spacer for editing in human cells.	Addgene	Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Vector	pPP444	Plasmid containing Homo sapiens codon optimized CasΦ-3 and spacer for editing in human cells.	Addgene	Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP12 (CasΦ-3)	Guide targeting eGFP compatible with CasΦ-3		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP18 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP1 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP1 (CasΦ-2)	Guide targeting eGFP compatible with CasΦ-2		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP23 (CasΦ-1)	Guide targeting eGFP compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP2 (CasΦ-2)	Guide targeting eGFP compatible with CasΦ-2		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	Cas12j-GFP7 (CasΦ-2)	Guide targeting eGFP compatible with CasΦ-2		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Guide	SapI-GG stuffer (CasΦ-1)	Non-targeting guide RNA targeting compatible with CasΦ-1		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells
Genome Editor	SpCas9	HA-SV40NLS-SpCas9-SV40NLS	Vector Encoded	Show Experiments (4) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway A novel human T cell platform to define biological adverse effects of genome editing Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Genome Editor	SpCas9		IDT	Show Experiments (2) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Delivery System	FSD238	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (3) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus
Guide	STS204 (DNMT1; Sp_t2:Sp_c20_Dnmt1)	For endogenous locus	in house production	Show Experiments (2) Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Delivery System	RNP-NC-CPP	The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity	Gong Lab	Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Experiment	Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system	Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The triGalNAc is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP-NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. Liver microtissue with a monoculture of primary human hepatocytes (PHH) was used. Each well of the liver-on-a-chip typically is seeded with 6.0 × 10^5 hepatocytes 16 hours prior to the addition of RNP-NCs with flow of 1.0 µl/s through the liver 3D microtissues. Lipofectamine – RNP complex was prepared using Lipofectamine 2000 Transfection Reagent with 1:1 weight to weight ratio after optimization of transfection efficiency. The goal of the experiment was to examine transfection efficiency by testing two doses 2.4 ug and 24 ug RNP-NCs [tri(GalNAc), TAT] with the help of imaging. Transfection of 24µg RNP-NC shows higher uptake when compared to2.4µg RNP-NC.		Show Project Comparing the efficiency and cellular impact of non-viral, hepatocyte-targeted delivery vehicles with viral-mediated gene delivery in a microphysiological liver on chip platform
Experiment	Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system	Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The triGalNAc is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP- NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. Liver microtissue with a monoculture of primary human hepatocytes (PHH) was used. Each well of the liver-on-a-chip typically is seeded with 6.0 × 10^5 hepatocytes 16 hours prior to the addition of RNP-NCs with flow of 1.0 µl/s through the liver 3D microtissues. Lipofectamine – RNP complex was prepared using Lipofectamine 2000 Transfection Reagent with 1:1 weight to weight ratio after optimization of transfection efficiency. The goal of the experiment was to quantify transfection efficiency by testing two doses 2.4 ug and 24 ug RNP-NCs [tri(GalNAc), TAT] using flow cytometry. Transfection of 24µg RNP-NC shows higher uptake when compared to2.4µg RNP-NC.		Show Project Comparing the efficiency and cellular impact of non-viral, hepatocyte-targeted delivery vehicles with viral-mediated gene delivery in a microphysiological liver on chip platform
Protocol	Heaney_SATC Tissue Processing, Imaging and Analysis	Procedure for tissue preparation, imaging and analysis.		Show Experiments (4) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Genome Editor	Alt-R® S.p. Cas9 Nuclease V3	Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol.	Integrated DNA Technologies	Show Experiments (10) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Validating Gene Editing Reporter 12 (GER12) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for NHEJ in Heterozygous Blastocysts Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 18 (GER18) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 19 (GER19) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for HDR in Heterozygous Blastocysts Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Homozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing

Contact SCGE

330 results for CRISPR

Select Category

OR Filter By ...

330 results for CRISPR

1. CRISPR-CasΦ from huge phages is a hypercompact genome editor.

7. CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity.

8. Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia.

[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

[Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain

[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.

AB_2532994

RRID:AB_10711040

AB_2813835

RRID:AB_2532994

[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain

[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver

RRID:AB_2536526

AB_141637

RRID:AB_1196615

RRID:AB_2798820

AB_10711040

RRID:AB_141637

RRID:AB_2813835

RRID:AB_141607

AB_2209751

AB_141607

RRID:AB_2209751