297 results for CRISPR

1. CRISPR-CasΦ from huge phages is a hypercompact genome editor.

Publication  - [In Vitro] [Genome Editors] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems name : CRISPR-CasΦ from huge phages is a hypercompact genome editor. description : CRISPR-Cas systems are found widely in prokaryotes, where they provide adaptive immunity against virus We describe a minimal functional CRISPR-Cas system, comprising a single ~70-kilodalton protein, CasΦ, and a CRISPR array, encoded exclusively in the genomes of huge bacteriophages. CasΦ uses a single active site for both CRISPR RNA (crRNA) processing and crRNA-guided DNA cutting to vitro and in human and plant cells with expanded target recognition capabilities relative to other CRISPR-Cas
Pausch P, Al-Shayeb B, Bisom-Rapp E, Tsuchida CA, Li Z, Cress BF, Knott GJ, Jacobsen SE, Banfield JF, Doudna JA
PII: 369/6501/333, PUBMED 32675376, PMC PMC8207990, MID NIHMS1702779, DOI 10.1126/science.abb1400

ABSTRACT: CRISPR-Cas systems are found widely in prokaryotes, where they provide adaptive immunity against virus infection and plasmid transformation. We describe a minimal functional CRISPR-Cas system, comprising a single ~70-kilodalton protein, CasΦ, and a CRISPR array, encoded exclusively in the genomes of huge bacteriophages. CasΦ uses a single active site for both CRISPR RNA (crRNA) processing and crRNA-guided DNA cutting to target foreign nucleic acids. This hypercompact system is active in vitro an ...
SCGE data tags...

Alt-R™ CRISPR-Cas9 Negative Control crRNA #1

Guide  - [In Vitro] [Human]
Matched Fields: deliverySystemName : CRISPRMAX grnaLabId : Alt-R CRISPR-Cas9 Negative Control crRNA #1 name : Alt-R™ CRISPR-Cas9 Negative Control crRNA #1 guide : Alt-R™ CRISPR-Cas9 Negative Control crRNA #1
Non-targeting control guide

3. Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia.

Publication  - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Mouse, Rhesus macaque]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors name : Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway description : These shuttle peptides, non-covalently combined with GFP protein or CRISPR-associated nuclease (Cas)
Krishnamurthy S, Wohlford-Lenane C, Kandimalla S, Sartre G, Meyerholz DK, Théberge V, Hallée S, Duperré AM, Del'Guidice T, Lepetit-Stoffaes JP, Barbeau X, Guay D, McCray PB
PII: 10.1038/s41467-019-12922-y, PUBMED 31659165, PMC PMC6817825, DOI 10.1038/s41467-019-12922-y

ABSTRACT: The delivery of biologic cargoes to airway epithelial cells is challenging due to the formidable barriers imposed by its specialized and differentiated cells. Among cargoes, recombinant proteins offer therapeutic promise but the lack of effective delivery methods limits their development. Here, we achieve protein and SpCas9 or AsCas12a ribonucleoprotein (RNP) delivery to cultured human well-differentiated airway epithelial cells and mouse lungs with engineered amphiphilic peptides. These shuttle ...
SCGE data tags...

Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain name : Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. description : Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene
Gong Sarah  Last Updated Date: 2020-10-28 NIH Report
 
Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression.

Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides

Project  - [In Vivo, In Vitro] [Delivery Systems]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides name : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
McCray Paul  Last Updated Date: 2020-11-02 NIH Report
 
The proposed research is relevant to the public health because genetic and acquired diseases affecting the airways pose major disease and economic burdens. By advancing the delivery of gene editing tools, it may be possible to therapeutically modify the cells lining the airways. This novel strategy has implications for the treatment of both monogenetic and acquired lungs disease, and may have applications for other somatic cell therapies.

Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases

Project  - [In Vivo, In Vitro] [Delivery Systems]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases name : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Gao Guang-Ping  Last Updated Date: 2021-09-21 NIH Report
 
Efficacy and safety limitations in current gene editing technologies have hindered efforts to treat genetic lung diseases. This proposal seeks to develop and validate a combinatorial delivery approach that uses non-viral and viral vehicles to efficiently transport gene editing tools to disease-relevant cells in the lung. Completion of our work will establish safe and effective delivery vehicles that will guide the design of future gene therapies for genetic disorders.

Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain

Project  - [In Vivo] [Delivery Systems]
Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain name : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain description : In vivo genome editing using CRISPR/Cas9 is anticipated to be the next wave of therapeutics for various
Gong Sarah  Last Updated Date: 2020-10-28 NIH Report
 
In vivo genome editing using CRISPR/Cas9 is anticipated to be the next wave of therapeutics for various major health threats, including neurodegenerative diseases. However, to date, very few Cas9-gRNA ribonucleoprotein in vivo delivery methods have been reported, and delivery to the brain has been particularly challenging. The unique nanocapsules we plan to develop will ultimately enable high efficiency neuron-targeted genome editing in the brain, thereby offering new hope to treat devastating neurodegenerative diseases.

8. CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity.

Publication  - [In Vitro] [Biological Effects] [Human]
Matched Fields: name : CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity. description : Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily
Lazzarotto CR, Malinin NL, Li Y, Zhang R, Yang Y, Lee G, Cowley E, He Y, Lan X, Jividen K, Katta V, Kolmakova NG, Petersen CT, Qi Q, Strelcov E, Maragh S, Krenciute G, Ma J, Cheng Y, Tsai SQ
PII: 10.1038/s41587-020-0555-7, PUBMED 32541958, PMC PMC7652380, MID NIHMS1591991, DOI 10.1038/s41587-020-0555-7

ABSTRACT: Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily scalable to the throughput needed to fully understand the principles that govern Cas9 specificity. Here we describe 'circularization for high-throughput analysis of nuclease genome-wide effects by sequencing' (CHANGE-seq), a scalable, automatable tagmentation-based method for measuring the genome-wide activity of Cas9 in vitro. We applied CHANGE-seq to 110 single guide RNA targets across 13 thera ...
SCGE data tags...

Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors

Project  - [In Vivo, In Vitro] [Delivery Systems]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors name : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors description : RNA-guided CRISPR genome editing systems promise to revolutionize the treatment of inherited disease. that directs editing is a critical hurdle in the development of clinical applications for engineered CRISPR nucleic acid therapeutics, we have established a framework for complete chemical modification of CRISPR
Sontheimer Erik  Last Updated Date: 2021-10-01 NIH Report
 
RNA-guided CRISPR genome editing systems promise to revolutionize the treatment of inherited disease. Safe, effective, and target-tissue-specific delivery of the guide RNA that directs editing is a critical hurdle in the development of clinical applications for engineered CRISPR systems. Using strategies validated for the delivery of other categories of nucleic acid therapeutics, we have established a framework for complete chemical modification of CRISPR guides, thereby conferring in vivo stability and effective biodistribution properties. The proposed research will optimize these guides, as well as other editing components, for clinical use.
Show Experiments (11)

[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: name : Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear description : Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice.
Murray Stephen  Last Updated Date: 2023-07-11 NIH Report
 
Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed.

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: name : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to description : Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice
Murray Stephen  Last Updated Date: 2023-05-10 NIH Report
 
Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: name : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to description : Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice
Murray Stephen  Last Updated Date: 2023-07-18 NIH Report
 
Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed.

Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems

Project  - [In Vitro] [Genome Editors]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems name : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems description : Expanding genome editing tools through exploration of new CRISPR-Cas proteins and DNA repair enzymes NARRATIVE Fundamental research on bacterial adaptive immunity uncovered the genome editing properties of CRISPR-Cas We will focus our investigation on newly described CRISPR-Cas systems and DNA-interacting proteins that
Banfield Jill , Doudna Jennifer  Last Updated Date: 2020-10-16 NIH Report
 
Expanding genome editing tools through exploration of new CRISPR-Cas proteins and DNA repair enzymes NARRATIVE Fundamental research on bacterial adaptive immunity uncovered the genome editing properties of CRISPR-Cas systems, and it is clear that uncultivated microbes contain more pathways and enzymes that may be useful as genome editing tools. We will combine bioinformatics and biochemistry to identify new DNA- and RNA-associating proteins and will analyze their mechanisms of action. We will focus our investigation on newly described CRISPR-Cas systems and DNA-interacting proteins that occur in conserved genomic context.

[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: name : Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear description : Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice
Murray Stephen  Last Updated Date: 2023-05-10 NIH Report
 
Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice

[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: name : Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia description : Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung
Heaney Jason  Last Updated Date: 2021-09-07 NIH Report
 
Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings

[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: name : Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 description : Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice
Murray Stephen  Last Updated Date: 2023-05-10 NIH Report
 
Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: name : Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 description : Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear
Murray Stephen  Last Updated Date: 2023-07-11 NIH Report
 
Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal.

[Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: name : Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR
Murray Stephen  Last Updated Date: 2023-05-10 NIH Report
 
Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections.

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

CRISPRMAX

Delivery System  - [In Vitro] [Human]
Matched Fields: name : CRISPRMAX deliverySystemName : CRISPRMAX grnaLabId : Alt-R CRISPR-Cas9 Negative Control crRNA #1 guide : Alt-R™ CRISPR-Cas9 Negative Control crRNA #1

kidney organoid

Model System  - [In Vitro] [Human]
Matched Fields: deliverySystemName : CRISPRMAX grnaLabId : Alt-R CRISPR-Cas9 Negative Control crRNA #1 guide : Alt-R™ CRISPR-Cas9 Negative Control crRNA #1
kidney organoid derived from human iPS cells

Alt-R™ S.p. HiFi Cas9 Nuclease V3

Genome Editor  - [In Vitro] [Human]
Matched Fields: deliverySystemName : CRISPRMAX grnaLabId : Alt-R CRISPR-Cas9 Negative Control crRNA #1 guide : Alt-R™ CRISPR-Cas9 Negative Control crRNA #1
Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. Has improved specificity based on reduced off-target effects.

[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: description : Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery.
Heaney Jason  Last Updated Date: 2021-03-30 NIH Report
 
Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.

[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: description : Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing
Heaney Jason  Last Updated Date: 2023-05-10 NIH Report
 
Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice

Analysis of editing outcomes and adverse events in human kidney organoids

Experiment  - [In Vitro] [Biological Effects] [Human]
Matched Fields: deliverySystemName : CRISPRMAX grnaLabId : Alt-R CRISPR-Cas9 Negative Control crRNA #1 description : These were transfected with a commercially available CRISPR ribonucleoprotein complex with guide RNA guide : Alt-R™ CRISPR-Cas9 Negative Control crRNA #1
Freedman Benjamin S  Last Updated Date: 2025-02-14 NIH Report
 
Kidney organoids were derived from a human iPS cell line expressing GFP from the safe harbor locus. These were transfected with a commercially available CRISPR ribonucleoprotein complex with guide RNA targeting GFP or a scrambled sequence (control). Editing events were assessed by next generation sequencing of the GFP locus.

[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: description : AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal
Heaney Jason  Last Updated Date: 2021-03-30 NIH Report
 
AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway

Focused Ultrasound-mediated Delivery of Gene-editing Elements to the Brain for Neurodegenerative Disorders

Project  - [In Vivo] [Delivery Systems]
Matched Fields: description : Current methodologies of delivering CRISPR-based gene editing elements to the brain are highly inefficient
Leong Kam  Last Updated Date: 2022-04-15 NIH Report
 
Gene editing may offer a new therapeutic strategy to tackle many neurodegenerative disorders that remain untreatable. Current methodologies of delivering CRISPR-based gene editing elements to the brain are highly inefficient. We propose to develop a noninvasive, efficient approach to achieve gene editing in the brain using focused ultrasound technology.

Podocyte-specific gene editing in human kidney organoids

Experiment  - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects]
Matched Fields: description : Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular
Wilson Ross , Freedman Benjamin S  Last Updated Date: 2024-01-16
 
Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter.

GFP-cRNA

Guide  - [In Vitro] [Human]
Matched Fields: deliverySystemName : CRISPRMAX

[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: description : Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were
Heaney Jason  Last Updated Date: 2023-12-18 NIH Report
 
Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced.

Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells

Experiment  - [In Vitro] [Delivery Systems] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
McCray Paul  Last Updated Date: 2020-11-02 NIH Report
 
Delivery of Cas9 RNP targeting human CFTR in Primary human epithelia cells. Gene editing efficiency was determined by percentage of NGS reads that showed an indel

Testing AAV5 for activation of tdTomato in HEK293T cells

Experiment  - [In Vitro] [Delivery Systems] [Human]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Gao Guang-Ping  Last Updated Date: 2020-10-20 NIH Report
 
AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence.

Ai14 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
McCray Paul  Last Updated Date: 2020-11-02 NIH Report
 
Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells.

Antibody  - [In Vivo] [Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Other Id:
Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200

FS48

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD112

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD116d1

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD160

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD168 cyclic

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

NK

Model System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Natural Killer cells. White blood cells;

FSD168D20

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

g-11_C9

Guide  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
sgRNA targeting CFTR exon 11

g-38330_C12a

Guide  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
gRNA targeting HPRT locus

NKG2A

Guide  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
gRNA targeting human NKG2A exon 3

FSD317

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD334

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD341

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD361

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD364

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD366

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD367

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD57d5

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD57d6

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

58. Focused ultrasound-mediated brain genome editing.

Publication  - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: description : focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR
Lao YH, Ji R, Zhou JK, Snow KJ, Kwon N, Saville E, He S, Chauhan S, Chi CW, Datta MS, Zhang H, Quek CH, Cai SS, Li M, Gaitan Y, Bechtel L, Wu SY, Lutz CM, Tomer R, Murray SA, Chavez A, Konofagou EE, Leong KW
PUBMED: 37579143, PMC PMC10450663, DOI 10.1073/pnas.2302910120

ABSTRACT: Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to ...
SCGE data tags...

Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts

Experiment  - [In Vitro] [Delivery Systems] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Sontheimer Erik  Last Updated Date: 2021-04-15 NIH Report
 
Chemically modified crRNA and tracrRNA were delivered by electroporation to embryonic fibroblasts harvested from the mTmG reporter mouse. Gene editing was determined by reporter activation.

HEK-293T-disrupted_GFP with MCV-mcherry-Puro

Model System  - [In Vitro] [Human]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
HEK293T cells with an integrated reporter for TLR-MCV1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.

Hepa1-6

Model System  - [In Vitro] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Stable mouse cell line of liver epithelial cells.

STS119 (TLR-MCV1b; Sp_t2:Sp_c20_TLR_MCV1b)

Guide  - [In Vitro] [Human]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Targets traffic light reporter transgene

STS134 (PCSK9b; Sp_t2:Sp_c20_PCSK9b)

Guide  - [In Vitro] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Targets endogenous mouse locus

STS159 (mTmG; Sp_t2:Sp_c0_mTmG)

Guide  - [In Vivo] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
This sgRNA targets the mTmG transgene

Gong_Intracranial Injection Procedure for Mice

Protocol  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
Procedure for intracranial delivery to mouse brain.

Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
McCray Paul  Last Updated Date: 2020-11-02 NIH Report
 
In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells.

Testing AAV5 for activation of tdTomato in mouse airway

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Gao Guang-Ping  Last Updated Date: 2020-10-20 NIH Report
 
AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation

BALB/c mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO).

FSD114

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD132

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD168d10

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD188

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD190

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

g-loxP2_C9

Guide  - [In Vivo] [Mouse]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
This sgRNA targets the Ai9 and related transgenes

FSD191

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD215

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

McCray_CFTR_Cas9_Guide1

Guide  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Targets endogenous human locus

FSD240

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD259

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD286

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD304

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD310

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD316

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD318

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD319

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD332

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD335

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD339

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD347

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

sgAi9R

Guide  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
This sgRNA targets the Ai9 and related transgenes

FSD359

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD360

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD365

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD67

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD97

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSX4

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

S10-MOD

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

S10 Scr.

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Sontheimer Erik  Last Updated Date: 2021-04-15 NIH Report
 
Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged.

Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Sontheimer Erik  Last Updated Date: 2021-10-01 NIH Report
 
Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain

Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells

Experiment  - [In Vitro] [Delivery Systems] [Human]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Sontheimer Erik  Last Updated Date: 2021-04-15 NIH Report
 
Chemically modified crRNA and tracrRNA were delivered by electroporation in presence of amphiphilic peptide to transgenic human HEK-293T cells harboring the TLR-MCV1 reporter. Gene editing was determined by reporter activation.

STS118 (TLR-MCV1a; Sp_t2-PS:Sp_c20_TLR_MCV1a)

Guide  - [In Vivo] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Targets traffic light reporter transgene, CY3 labeled

STS159 (mTmG; Sp_t2-PS:Sp_c20_mTmG)

Guide  - [In Vivo] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
This sgRNA targets the mTmG transgene

STS204 (DNMT1; Sp_t41:Sp_c20_Dnmt1)

Guide  - [In Vitro] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Targets endogenous mouse locus

STS205 (BACE1; Sp_t41:Sp_c20_Bace1)

Guide  - [In Vitro] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Targets endogenous mouse locus

STS96 (PCSK9a; Sp_t2:Sp_c20_PCSK9a)

Guide  - [In Vitro] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Targets endogenous mouse locus

3849 45-5'

Guide  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Targets endogenous human locus

Antibody  - [In Vivo] [Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Other Id:
Anti-RFP (RABBIT) Antibody

AsCas12a (IDT and Feldan Therapeutics)

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides

CM18-PTD4

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide

FS66d6

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD121

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

HEK-293T with Ai9 transient reporter assay

Model System  - [In Vitro] [Human]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.

FSD122

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD168d20

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide

FSD196

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD234

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD283

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD291

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD307

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD308

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD329

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

sgAi9L

Guide  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
This sgRNA targets the Ai9 and related transgenes

FSD63

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD94

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSX1

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSX2

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSX8

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

pAAV.pU1a-SpCas9

Vector  - [In Vitro] [Human]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS

FSD117D1

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Shuttle peptide used to deliver reagents to airway epithelia

Cas12j-GFP12 (CasΦ-3)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-3

Cas12j-GFP16 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP18 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP2 (CasΦ-2)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-2

Cas12j-GFP6 (CasΦ-2)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-2

Cas12j-GFP9 (CasΦ-2)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-2

Cas12j-GFP9 (CasΦ-3)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-3

SapI-GG stuffer (CasΦ-3)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Non-targeting guide RNA targeting compatible with CasΦ-3

pPP444

Vector  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Plasmid containing Homo sapiens codon optimized CasΦ-3 and spacer for editing in human cells.

Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells

Experiment  - [In Vitro] [Delivery Systems] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Sontheimer Erik  Last Updated Date: 2021-04-15 NIH Report
 
Chemically modified crRNA and tracrRNA were delivered by electroporation to mouse Hepa 1-6 cells. Editing activity was determined by Sanger sequencing

Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Sontheimer Erik  Last Updated Date: 2021-04-15 NIH Report
 
Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged.

Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Sontheimer Erik  Last Updated Date: 2021-04-15 NIH Report
 
Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged.

RRID:AB_2798820 

Antibody  - [In Vivo] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Other Id: AB_2798820
Cas9 (S. pyogenes) (E7M1H) XP® Rabbit mAb antibody, Cell Signaling Technology

Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells

Experiment  - [In Vitro] [Delivery Systems] [Human]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Sontheimer Erik  Last Updated Date: 2021-04-15 NIH Report
 
Chemically modified crRNA and tracrRNA were delivered by electroporation to transgenic human HEK-293T cells harboring the TLR1 reporter. Gene editing was determined by reporter activation.

Mouse Embryonic Fibroblasts

Model System  - [In Vitro] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Primary cell line

SpyCas9-3xNLS

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal
Show Experiments (5)

STS135 (PCSK9c; Sp_t2:Sp_c20_PCSK9c)

Guide  - [In Vitro] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Targets endogenous mouse locus

Ai9-SauSpyCas9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: description : Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional
Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.

Antibody  - [In Vivo] [Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Other Id:
GFP (D5.1) XP Rabbit mAb antibody

Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.

Experiment  - [In Vitro] [Delivery Systems] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
McCray Paul  Last Updated Date: 2020-11-02 NIH Report
 
In Vitro shuttle peptide delivery of Cas12a RNPs targeting human CFTR and HPRT genes in human primary airway epithelia. Editing efficiency was assessed after 72hrs by sanger sequencing.

Antibody  - [In Vivo] [Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Other Id:
Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300

GFP-NLS

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Nuclear targeted GFP

FSD115

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

mTmG mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence

FSD159

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Gao Guang-Ping  Last Updated Date: 2021-09-21 NIH Report
 
AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.

FSD168

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD168d11

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD168d12

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD168d17

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

g-45_C12a

Guide  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
gRNA targeting CFTR inton-22-23

g-loxPbot_C12a

Guide  - [In Vivo] [Mouse]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
This sgRNA targets the Ai9 and related transgenes at two sites

FSD199

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD216

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD222

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD227

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD235

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD239

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD260

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD284

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD293

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD297

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD303

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD322

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD331

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD362

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD363

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD368

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD57d4

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSX5

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

AAV.pU1a-SpCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS

S18

Delivery System  - [In Vitro] [Human, Mouse]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide

S85

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide

H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)

Vector  - [In Vivo] [Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP

Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells

Experiment  - [In Vitro] [Delivery Systems] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
McCray Paul  Last Updated Date: 2020-11-02 NIH Report
 
Delivery of Cas12a RNP targeting human CFTR in Primary human epithelia cells. Gene editing efficiency was determined by percentage of NGS reads that showed an indel

Gene editing in vitro by various peptide variants delivering Cas12a in NK cells.

Experiment  - [In Vitro] [Delivery Systems] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
McCray Paul  Last Updated Date: 2020-11-02 NIH Report
 
In Vitro shuttle peptide delivery of Cas12a RNP targeting human NKG2A gene in human NK cells. Gene editing was assessed after 48hr by T7E1 digestion.

Antibody  - [In Vivo] [Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Other Id:
Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000

Antibody  - [In Vivo] [Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Other Id:
Anti-RFP (Rabbit) Polyclonal Antibody

Cre recombinase

Genome Editor  - [In Vitro] [Human]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Cre recombinase delivered by plasmid (see vector details)

FSD118

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD147

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD168 Disul.

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD168 Scr.

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD186

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD189

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD193

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD228

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD236

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD287

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD288

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD289

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD305

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD306

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD323

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD330

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD333

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD57

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD57d1

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD57d3

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD96

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSX3

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSX6

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSX7

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

S10D

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

pH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)

Vector  - [In Vitro] [Human]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP

Cas12j-GFP10 (CasΦ-2)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-2

Cas12j-GFP3 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP5 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP5 (CasΦ-2)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-2

Cas12j-GFP5 (CasΦ-3)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-3

Cas12j-GFP8 (CasΦ-3)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-3

HEK-293-TgEF1a-eGFP-BSD

Model System  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
HEK293 cells with lentiviral insertion of EF1a promoter driving expression of eGFP and SV40 promoter driving expression of BSD. HEK293 is an epithelial-like cell that was isolated from the kidney of a patient.

S10

Delivery System  - [In Vivo, In Vitro] [Human, Mouse, Rhesus macaque]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Shuttle peptide used to deliver reagents to airway epithelia
Show Experiments (12)

Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Sontheimer Erik  Last Updated Date: 2021-04-15 NIH Report
 
Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged.

HEK-293T-disrupted_GFP-mcherry-Puro

Model System  - [In Vitro] [Human]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
HEK293T cells with an integrated reporter for TLR1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.

Neuro 2A

Model System  - [In Vitro] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Neuro-2a cells are mouse neuroblasts with neuronal and amoeboid stem cell morphology isolated from brain tissue.

TLR-MCV1 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
TLR-MCV1 transgene knocked into Rosa26 locus

STS118 (TLR-MCV1a; Sp_t2:Sp_c20_TLR_MCV1a)

Guide  - [In Vitro] [Human]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Targets traffic light reporter transgene

STS120 (TLR1; Sp_t2:Sp_c20_TLR1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Targets traffic light reporter transgene

Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells

Experiment  - [In Vitro] [Delivery Systems] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Sontheimer Erik  Last Updated Date: 2021-04-15 NIH Report
 
Chemically modified crRNA and tracrRNA were delivered by electroporation to mouse Neuro2A cells. Editing activity was determined by Sanger sequencing

Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Sontheimer Erik  Last Updated Date: 2021-04-15 NIH Report
 
Chemically modified crRNA and tracrRNA were injected into the striatum of TLR-MCV mice and the distribution of RNP was imaged.

STS159 (mTmG; Sp_t2-PS:Sp_c0_mTmG)

Guide  - [In Vivo] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
This sgRNA targets the mTmG transgene

FSD115d1

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD237

Delivery System  - [In Vitro] [Human, Mouse, Rhesus macaque]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD285

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD301

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

Cas12j-GFP13 (CasΦ-3)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-3

Cas12j-GFP14 (CasΦ-2)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-2

Cas12j-GFP1 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP3 (CasΦ-2)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-2

Cas12j-GFP4 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP4 (CasΦ-2)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-2

SapI-GG stuffer (CasΦ-2)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Non-targeting guide RNA targeting compatible with CasΦ-2

pPP441

Vector  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Plasmid containing Homo sapiens codon optimized CasΦ-2 and spacer for editing in human cells.

Lipofectamine 3000

Delivery System  - [In Vitro] [Human, Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Lipid nanoparticle

Testing newly discovered Biggie Phage editors in human cells

Experiment  - [In Vitro] [Genome Editors] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Banfield Jill , Doudna Jennifer  Last Updated Date: 2020-10-16 NIH Report
 

Cas12j-GFP11 (CasΦ-3)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-3

Cas12j-GFP17 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP19 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP1 (CasΦ-2)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-2

Cas12j-GFP21 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP22 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP23 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP8 (CasΦ-2)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-2

CasΦ-1

Genome Editor  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies

CasΦ-2

Genome Editor  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies

CasΦ-3

Genome Editor  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies

Cas12j-GFP10 (CasΦ-3)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-3

Cas12j-GFP14 (CasΦ-3)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-3

Cas12j-GFP15 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP20 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP2 (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-1

Cas12j-GFP6 (CasΦ-3)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-3

Cas12j-GFP7 (CasΦ-2)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-2

Cas12j-GFP7 (CasΦ-3)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Guide targeting eGFP compatible with CasΦ-3

SapI-GG stuffer (CasΦ-1)

Guide  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Non-targeting guide RNA targeting compatible with CasΦ-1

pPP394

Vector  - [In Vitro] [Human]
Matched Fields: study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems
Plasmid containing Homo sapiens codon optimized CasΦ-1 and spacer for editing in human cells.

FSD114d1

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD195

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD238

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD315

Delivery System  - [In Vivo, In Vitro] [Human, Mouse, Rhesus macaque]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia
Show Experiments (7)

STS204 (DNMT1; Sp_t2:Sp_c20_Dnmt1)

Guide  - [In Vivo] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
For endogenous locus

FSD197

Delivery System  - [In Vitro] [Human]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD63D1

Delivery System  - [In Vitro] [Human, Rhesus macaque]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

FSD95

Delivery System  - [In Vitro] [Human, Rhesus macaque]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Shuttle peptide used to deliver reagents to airway epithelia

SpCas9

Genome Editor  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
HA-SV40NLS-SpCas9-SV40NLS

SpyCas9-3xNLS

Genome Editor  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal

Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts

Experiment  - [In Vitro] [Animal Reporter and Testing Center]
Matched Fields: description : Zyotes were electroporated with various CRISPR/Cas9 combinations (or Cre) and were cultured 96 hours
Murray Stephen  Last Updated Date: 2024-02-23 NIH Report
 
WT female mouse and homozygous male mouse containing the Gene Editing Reporter 14 (GER14) reporter at the Rosa26 locus were mated. Females were super-ovulated and zygotes harvested. Zyotes were electroporated with various CRISPR/Cas9 combinations (or Cre) and were cultured 96 hours to blastocyst stage. Blastocysts were imaged for Katushka2S (RFP) fluorescence and scored for fluorescence signal. Blastocysts were then PCR amplified for the reporter allele and Sanger sequenced. ICE analysis tool from Synthego was used to score edits. NOTE: Some blasts did not PCR amplify well and it could not be determined if they had edits. Total blasts analyzed expressing the fluorescent reporter, 46-164. Total blast analyzed by Sanger sequencing, 39-142.

Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control

Experiment  - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects]
Matched Fields: description : Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles provided
Gong Sarah , Wilson Ross , Kiani Samira  Last Updated Date: 2023-12-18
 
Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles provided from the Gong Lab at the University of Wisconsin-Madison. The Gong lab conducted free radical polymerization of the monomer coating with (PEG)-acrylate to ensure that the RNP-NC be stable and able to conjugate different ligands. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The tri(GalNAc) is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP-NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. The goal was to investigate cellular uptake of Cas9-gRNA nanocapsules using imaging after 24 hours and to determine the appropriate ratio for Lipofectamine-RNP positive control.

RRID:AB_2536526 

Antibody  - [In Vivo] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Other Id: Thermo Fisher Scientific Cat# G10362 Vector Labs Cat# BA-1000
GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362

Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system

Experiment  - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects]
Matched Fields: description : Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles.
Gong Sarah , Wilson Ross , Kiani Samira  Last Updated Date: 2023-12-18
 
Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The triGalNAc is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP-NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. Liver microtissue with a monoculture of primary human hepatocytes (PHH) was used. Each well of the liver-on-a-chip typically is seeded with 6.0 × 10^5 hepatocytes 16 hours prior to the addition of RNP-NCs with flow of 1.0 µl/s through the liver 3D microtissues. Lipofectamine – RNP complex was prepared using Lipofectamine 2000 Transfection Reagent with 1:1 weight to weight ratio after optimization of transfection efficiency. The goal of the experiment was to examine transfection efficiency by testing two doses 2.4 ug and 24 ug RNP-NCs [tri(GalNAc), TAT] with the help of imaging. Transfection of 24µg RNP-NC shows higher uptake when compared to2.4µg RNP-NC.

Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system

Experiment  - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects]
Matched Fields: description : Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles.
Gong Sarah , Wilson Ross , Kiani Samira  Last Updated Date: 2023-12-18
 
Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The triGalNAc is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP- NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. Liver microtissue with a monoculture of primary human hepatocytes (PHH) was used. Each well of the liver-on-a-chip typically is seeded with 6.0 × 10^5 hepatocytes 16 hours prior to the addition of RNP-NCs with flow of 1.0 µl/s through the liver 3D microtissues. Lipofectamine – RNP complex was prepared using Lipofectamine 2000 Transfection Reagent with 1:1 weight to weight ratio after optimization of transfection efficiency. The goal of the experiment was to quantify transfection efficiency by testing two doses 2.4 ug and 24 ug RNP-NCs [tri(GalNAc), TAT] using flow cytometry. Transfection of 24µg RNP-NC shows higher uptake when compared to2.4µg RNP-NC.

290. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing.

Publication  - [In Vivo] [Delivery Systems, DCC, AAV tropism, Animal Reporter and Testing Center] [Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases description : serotype 9 as evidenced by robust reporter and therapeutic gene expression, Cre recombination and CRISPR
Gonzalez TJ, Simon KE, Blondel LO, Fanous MM, Roger AL, Maysonet MS, Devlin GW, Smith TJ, Oh DK, Havlik LP, Castellanos Rivera RM, Piedrahita JA, ElMallah MK, Gersbach CA, Asokan A
PII: 10.1038/s41467-022-33745-4, PUBMED 36210364, PMC PMC9548504, DOI 10.1038/s41467-022-33745-4

ABSTRACT: Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attrib ...
SCGE data tags...

mTmG mouse (congenic)

Model System  - [In Vivo] [Mouse]
Matched Fields: study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed.
Show Experiments (7)

Ai14 gRNA

Guide  - [In Vivo] [Mouse]
Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
This sgRNA targets the Ai9 and related transgenes at multiple sites

RNP-NC-no ligand

Delivery System  - [In Vivo, In Vitro] [Mouse]
Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA.

RNP-NC-CPP

Delivery System  - [In Vivo, In Vitro] [Mouse]
Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity

sNLS-SpCas9-sNLS

Genome Editor  - [In Vivo, In Vitro] [Mouse]
Matched Fields: study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
SpCas9 with N- and C-terminal SV40 NLS

Ai9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.
Show Experiments (11)

Alt-R™ S.p. Cas9 Nuclease V3

Genome Editor  - [In Vivo, In Vitro] [Mouse]
Matched Fields: study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol.
Show Experiments (10)

297 results for CRISPR

Category Name Description Source View Associated...
Publication CRISPR-CasΦ from huge phages is a hypercompact genome editor. CRISPR-Cas systems are found widely in prokaryotes, where they provide adaptive immunity against virus infection and plasmid transformation. We describe a minimal functional CRISPR-Cas system, comprising a single ~70-kilodalton protein, CasΦ, and a CRISPR array, encoded exclusively in the genomes of huge bacteriophages. CasΦ uses a single active site for both CRISPR RNA (crRNA) processing and crRNA-guided DNA cutting to target foreign nucleic acids. This hypercompact system is active in vitro and in human and plant cells with expanded target recognition capabilities relative to other CRISPR-Cas proteins. Useful for genome editing and DNA detection but with a molecular weight half that of Cas9 and Cas12a genome-editing enzymes, CasΦ offers advantages for cellular delivery that expand the genome editing toolbox.
Guide Alt-R™ CRISPR-Cas9 Negative Control crRNA #1 Non-targeting control guide IDT
Publication Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia. The delivery of biologic cargoes to airway epithelial cells is challenging due to the formidable barriers imposed by its specialized and differentiated cells. Among cargoes, recombinant proteins offer therapeutic promise but the lack of effective delivery methods limits their development. Here, we achieve protein and SpCas9 or AsCas12a ribonucleoprotein (RNP) delivery to cultured human well-differentiated airway epithelial cells and mouse lungs with engineered amphiphilic peptides. These shuttle peptides, non-covalently combined with GFP protein or CRISPR-associated nuclease (Cas) RNP, allow rapid entry into cultured human ciliated and non-ciliated epithelial cells and mouse airway epithelia. Instillation of shuttle peptides combined with SpCas9 or AsCas12a RNP achieves editing of loxP sites in airway epithelia of ROSAmT/mG mice. We observe no evidence of short-term toxicity with a widespread distribution restricted to the respiratory tract. This peptide-based technology advances potential therapeutic avenues for protein and Cas RNP delivery to refractory airway epithelial cells.
Experiment Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression.
Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides The proposed research is relevant to the public health because genetic and acquired diseases affecting the airways pose major disease and economic burdens. By advancing the delivery of gene editing tools, it may be possible to therapeutically modify the cells lining the airways. This novel strategy has implications for the treatment of both monogenetic and acquired lungs disease, and may have applications for other somatic cell therapies.
Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Efficacy and safety limitations in current gene editing technologies have hindered efforts to treat genetic lung diseases. This proposal seeks to develop and validate a combinatorial delivery approach that uses non-viral and viral vehicles to efficiently transport gene editing tools to disease-relevant cells in the lung. Completion of our work will establish safe and effective delivery vehicles that will guide the design of future gene therapies for genetic disorders.
Project Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain In vivo genome editing using CRISPR/Cas9 is anticipated to be the next wave of therapeutics for various major health threats, including neurodegenerative diseases. However, to date, very few Cas9-gRNA ribonucleoprotein in vivo delivery methods have been reported, and delivery to the brain has been particularly challenging. The unique nanocapsules we plan to develop will ultimately enable high efficiency neuron-targeted genome editing in the brain, thereby offering new hope to treat devastating neurodegenerative diseases.
Publication CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity. Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily scalable to the throughput needed to fully understand the principles that govern Cas9 specificity. Here we describe 'circularization for high-throughput analysis of nuclease genome-wide effects by sequencing' (CHANGE-seq), a scalable, automatable tagmentation-based method for measuring the genome-wide activity of Cas9 in vitro. We applied CHANGE-seq to 110 single guide RNA targets across 13 therapeutically relevant loci in human primary T cells and identified 201,934 off-target sites, enabling the training of a machine learning model to predict off-target activity. Comparing matched genome-wide off-target, chromatin modification and accessibility, and transcriptional data, we found that cellular off-target activity was two to four times more likely to occur near active promoters, enhancers and transcribed regions. Finally, CHANGE-seq analysis of six targets across eight individual genomes revealed that human single-nucleotide variation had significant effects on activity at ~15.2% of off-target sites analyzed. CHANGE-seq is a simplified, sensitive and scalable approach to understanding the specificity of genome editors.
Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors RNA-guided CRISPR genome editing systems promise to revolutionize the treatment of inherited disease. Safe, effective, and target-tissue-specific delivery of the guide RNA that directs editing is a critical hurdle in the development of clinical applications for engineered CRISPR systems. Using strategies validated for the delivery of other categories of nucleic acid therapeutics, we have established a framework for complete chemical modification of CRISPR guides, thereby conferring in vivo stability and effective biodistribution properties. The proposed research will optimize these guides, as well as other editing components, for clinical use.
Show Experiments (11)
Experiment [Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed.
Experiment [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice
Experiment [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed.
Project Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems Expanding genome editing tools through exploration of new CRISPR-Cas proteins and DNA repair enzymes NARRATIVE Fundamental research on bacterial adaptive immunity uncovered the genome editing properties of CRISPR-Cas systems, and it is clear that uncultivated microbes contain more pathways and enzymes that may be useful as genome editing tools. We will combine bioinformatics and biochemistry to identify new DNA- and RNA-associating proteins and will analyze their mechanisms of action. We will focus our investigation on newly described CRISPR-Cas systems and DNA-interacting proteins that occur in conserved genomic context.
Experiment [Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice
Experiment [Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings
Experiment [Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Experiment Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Experiment [Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal.
Experiment [Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections.
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Delivery System CRISPRMAX Thermo Fisher
Model System kidney organoid kidney organoid derived from human iPS cells Coriell Institute for Medical Research
Genome Editor Alt-R™ S.p. HiFi Cas9 Nuclease V3 Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. Has improved specificity based on reduced off-target effects. Integrated DNA Technologies (IDT)
Experiment [Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.
Experiment [Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice
Experiment Analysis of editing outcomes and adverse events in human kidney organoids Kidney organoids were derived from a human iPS cell line expressing GFP from the safe harbor locus. These were transfected with a commercially available CRISPR ribonucleoprotein complex with guide RNA targeting GFP or a scrambled sequence (control). Editing events were assessed by next generation sequencing of the GFP locus.
Experiment [Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway
Project Focused Ultrasound-mediated Delivery of Gene-editing Elements to the Brain for Neurodegenerative Disorders Gene editing may offer a new therapeutic strategy to tackle many neurodegenerative disorders that remain untreatable. Current methodologies of delivering CRISPR-based gene editing elements to the brain are highly inefficient. We propose to develop a noninvasive, efficient approach to achieve gene editing in the brain using focused ultrasound technology.
Experiment Podocyte-specific gene editing in human kidney organoids Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter.
Guide GFP-cRNA IDT
Experiment [Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced.
Experiment Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Delivery of Cas9 RNP targeting human CFTR in Primary human epithelia cells. Gene editing efficiency was determined by percentage of NGS reads that showed an indel
Experiment Testing AAV5 for activation of tdTomato in HEK293T cells AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence.
Model System Ai14 mouse Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory
Experiment Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells.
Antibody Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200
Delivery System FS48 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD112 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD116d1 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD160 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD168 cyclic Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Model System NK Natural Killer cells. White blood cells; GreenCross LabCell
Delivery System FSD168D20 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Guide g-11_C9 sgRNA targeting CFTR exon 11 IDT
Guide g-38330_C12a gRNA targeting HPRT locus IDT
Guide NKG2A gRNA targeting human NKG2A exon 3 IDT
Delivery System FSD317 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD334 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD341 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD361 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD364 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD366 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD367 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD57d5 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD57d6 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Publication Focused ultrasound-mediated brain genome editing. Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to the brain.
Experiment Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Chemically modified crRNA and tracrRNA were delivered by electroporation to embryonic fibroblasts harvested from the mTmG reporter mouse. Gene editing was determined by reporter activation.
Antibody RRID:AB_1196615  GFP (D5.1) XP Rabbit mAb antibody, Cell Signaling Technology
Model System HEK-293T-disrupted_GFP with MCV-mcherry-Puro HEK293T cells with an integrated reporter for TLR-MCV1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.
Model System Hepa1-6 Stable mouse cell line of liver epithelial cells. ATCC
Guide STS119 (TLR-MCV1b; Sp_t2:Sp_c20_TLR_MCV1b) Targets traffic light reporter transgene In house production
Guide STS134 (PCSK9b; Sp_t2:Sp_c20_PCSK9b) Targets endogenous mouse locus In house production
Guide STS159 (mTmG; Sp_t2:Sp_c0_mTmG) This sgRNA targets the mTmG transgene In house production
Protocol Gong_Intracranial Injection Procedure for Mice Procedure for intracranial delivery to mouse brain.
Experiment Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells.
Experiment Testing AAV5 for activation of tdTomato in mouse airway AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation
Model System BALB/c mouse BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). The Jackson Laboratory
Delivery System FSD114 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD132 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD168d10 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD188 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD190 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Guide g-loxP2_C9 This sgRNA targets the Ai9 and related transgenes IDT
Delivery System FSD191 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD215 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Guide McCray_CFTR_Cas9_Guide1 Targets endogenous human locus IDT
Delivery System FSD240 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD259 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD286 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD304 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD310 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD316 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD318 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD319 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD332 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD335 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD339 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD347 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Guide sgAi9R This sgRNA targets the Ai9 and related transgenes IDT
Delivery System FSD359 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD360 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD365 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD67 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD97 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSX4 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System S10-MOD Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System S10 Scr. Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Experiment Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged.
Experiment Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain
Experiment Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells Chemically modified crRNA and tracrRNA were delivered by electroporation in presence of amphiphilic peptide to transgenic human HEK-293T cells harboring the TLR-MCV1 reporter. Gene editing was determined by reporter activation.
Guide STS118 (TLR-MCV1a; Sp_t2-PS:Sp_c20_TLR_MCV1a) Targets traffic light reporter transgene, CY3 labeled In house production
Guide STS159 (mTmG; Sp_t2-PS:Sp_c20_mTmG) This sgRNA targets the mTmG transgene In house production
Guide STS204 (DNMT1; Sp_t41:Sp_c20_Dnmt1) Targets endogenous mouse locus In house production
Guide STS205 (BACE1; Sp_t41:Sp_c20_Bace1) Targets endogenous mouse locus In house production
Guide STS96 (PCSK9a; Sp_t2:Sp_c20_PCSK9a) Targets endogenous mouse locus In house production
Guide 3849 45-5' Targets endogenous human locus IDT
Antibody Anti-RFP (RABBIT) Antibody
Genome Editor AsCas12a (IDT and Feldan Therapeutics) IDT and Feldan Therapeutics
Delivery System CM18-PTD4 Shuttle peptide Feldan Therapeutics (synthetic peptide from GL Biochem, 95% purity)
Delivery System FS66d6 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD121 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Model System HEK-293T with Ai9 transient reporter assay HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.
Delivery System FSD122 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD168d20 Shuttle peptide Feldan Therapeutics (synthetic peptide from GL Biochem, 95% purity)
Delivery System FSD196 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD234 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD283 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD291 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD307 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD308 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD329 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Guide sgAi9L This sgRNA targets the Ai9 and related transgenes IDT
Delivery System FSD63 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD94 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSX1 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSX2 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSX8 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Vector pAAV.pU1a-SpCas9 Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS Addgene
Delivery System FSD117D1 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Guide Cas12j-GFP12 (CasΦ-3) Guide targeting eGFP compatible with CasΦ-3
Guide Cas12j-GFP16 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP18 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP2 (CasΦ-2) Guide targeting eGFP compatible with CasΦ-2
Guide Cas12j-GFP6 (CasΦ-2) Guide targeting eGFP compatible with CasΦ-2
Guide Cas12j-GFP9 (CasΦ-2) Guide targeting eGFP compatible with CasΦ-2
Guide Cas12j-GFP9 (CasΦ-3) Guide targeting eGFP compatible with CasΦ-3
Guide SapI-GG stuffer (CasΦ-3) Non-targeting guide RNA targeting compatible with CasΦ-3
Vector pPP444 Plasmid containing Homo sapiens codon optimized CasΦ-3 and spacer for editing in human cells. Addgene
Experiment Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Chemically modified crRNA and tracrRNA were delivered by electroporation to mouse Hepa 1-6 cells. Editing activity was determined by Sanger sequencing
Experiment Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged.
Experiment Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged.
Antibody RRID:AB_2798820  Cas9 (S. pyogenes) (E7M1H) XP® Rabbit mAb antibody, Cell Signaling Technology
Experiment Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells Chemically modified crRNA and tracrRNA were delivered by electroporation to transgenic human HEK-293T cells harboring the TLR1 reporter. Gene editing was determined by reporter activation.
Model System Mouse Embryonic Fibroblasts Primary cell line In-house: https://jacks-lab.mit.edu/protocols/making_mefs
Genome Editor SpyCas9-3xNLS SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal Sontheimer lab
Show Experiments (5)
Guide STS135 (PCSK9c; Sp_t2:Sp_c20_PCSK9c) Targets endogenous mouse locus In house production
Model System Ai9-SauSpyCas9 mouse Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Baylor College of Medicine
Model System Primary Airway Epithelia (Human) Primary airway epithelia from non-CF donors University of Iowa
Delivery System FSD262 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD321 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Antibody GFP (D5.1) XP Rabbit mAb antibody
Experiment Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. In Vitro shuttle peptide delivery of Cas12a RNPs targeting human CFTR and HPRT genes in human primary airway epithelia. Editing efficiency was assessed after 72hrs by sanger sequencing.
Antibody Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300
Genome Editor GFP-NLS Nuclear targeted GFP Expressed From (Escherichia coli BL21DE3)
Delivery System FSD115 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Model System mTmG mouse ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence The Jackson Laboratory
Delivery System FSD159 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Experiment Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.
Delivery System FSD168 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD168d11 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD168d12 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD168d17 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Guide g-45_C12a gRNA targeting CFTR inton-22-23 IDT
Guide g-loxPbot_C12a This sgRNA targets the Ai9 and related transgenes at two sites IDT
Delivery System FSD199 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD216 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD222 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD227 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD235 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD239 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD260 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD284 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD293 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD297 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD303 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD322 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD331 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD362 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD363 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD368 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD57d4 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSX5 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Vector AAV.pU1a-SpCas9 Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS Addgene
Delivery System S18 Shuttle peptide Feldan Therapeutics (synthetic peptide from GL Biochem, 95% purity)
Delivery System S85 Shuttle peptide Feldan Therapeutics (synthetic peptide from GL Biochem, 95% purity)
Vector H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP Gao Lab
Experiment Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas12a RNP targeting human CFTR in Primary human epithelia cells. Gene editing efficiency was determined by percentage of NGS reads that showed an indel
Genome Editor AsCas12a (Feldan Therapeutics) Feldan Therapeutics
Experiment Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. In Vitro shuttle peptide delivery of Cas12a RNP targeting human NKG2A gene in human NK cells. Gene editing was assessed after 48hr by T7E1 digestion.
Antibody Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000
Antibody Anti-RFP (Rabbit) Polyclonal Antibody
Genome Editor Cre recombinase Cre recombinase delivered by plasmid (see vector details)
Delivery System FSD118 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD147 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD168 Disul. Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD168 Scr. Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD186 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD189 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD193 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD228 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD236 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD287 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD288 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD289 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD305 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD306 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD323 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD330 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD333 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD57 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD57d1 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD57d3 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD96 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSX3 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSX6 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSX7 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System S10D Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Vector pH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP Gao Lab
Guide Cas12j-GFP10 (CasΦ-2) Guide targeting eGFP compatible with CasΦ-2
Guide Cas12j-GFP3 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP5 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP5 (CasΦ-2) Guide targeting eGFP compatible with CasΦ-2
Guide Cas12j-GFP5 (CasΦ-3) Guide targeting eGFP compatible with CasΦ-3
Guide Cas12j-GFP8 (CasΦ-3) Guide targeting eGFP compatible with CasΦ-3
Model System HEK-293-TgEF1a-eGFP-BSD HEK293 cells with lentiviral insertion of EF1a promoter driving expression of eGFP and SV40 promoter driving expression of BSD. HEK293 is an epithelial-like cell that was isolated from the kidney of a patient.
Delivery System S10 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Show Experiments (12)
Experiment Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Chemically modified crRNA and tracrRNA were injected into the intra-striatum of mTmG reporter mice and activation of GFP expression was imaged.
Model System HEK-293T-disrupted_GFP-mcherry-Puro HEK293T cells with an integrated reporter for TLR1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.
Model System Neuro 2A Neuro-2a cells are mouse neuroblasts with neuronal and amoeboid stem cell morphology isolated from brain tissue. ATCC
Model System TLR-MCV1 mouse TLR-MCV1 transgene knocked into Rosa26 locus
Guide STS118 (TLR-MCV1a; Sp_t2:Sp_c20_TLR_MCV1a) Targets traffic light reporter transgene In house production
Guide STS120 (TLR1; Sp_t2:Sp_c20_TLR1) Targets traffic light reporter transgene In house production
Experiment Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells Chemically modified crRNA and tracrRNA were delivered by electroporation to mouse Neuro2A cells. Editing activity was determined by Sanger sequencing
Experiment Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain Chemically modified crRNA and tracrRNA were injected into the striatum of TLR-MCV mice and the distribution of RNP was imaged.
Guide STS159 (mTmG; Sp_t2-PS:Sp_c0_mTmG) This sgRNA targets the mTmG transgene In house production
Delivery System FSD115d1 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD237 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD285 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD301 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Guide Cas12j-GFP13 (CasΦ-3) Guide targeting eGFP compatible with CasΦ-3
Guide Cas12j-GFP14 (CasΦ-2) Guide targeting eGFP compatible with CasΦ-2
Guide Cas12j-GFP1 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP3 (CasΦ-2) Guide targeting eGFP compatible with CasΦ-2
Guide Cas12j-GFP4 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP4 (CasΦ-2) Guide targeting eGFP compatible with CasΦ-2
Guide SapI-GG stuffer (CasΦ-2) Non-targeting guide RNA targeting compatible with CasΦ-2
Vector pPP441 Plasmid containing Homo sapiens codon optimized CasΦ-2 and spacer for editing in human cells. Addgene
Delivery System Lipofectamine 3000 Lipid nanoparticle Thermo Fisher Scientific
Experiment Testing newly discovered Biggie Phage editors in human cells
Guide Cas12j-GFP11 (CasΦ-3) Guide targeting eGFP compatible with CasΦ-3
Guide Cas12j-GFP17 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP19 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP1 (CasΦ-2) Guide targeting eGFP compatible with CasΦ-2
Guide Cas12j-GFP21 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP22 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP23 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP8 (CasΦ-2) Guide targeting eGFP compatible with CasΦ-2
Genome Editor CasΦ-1 Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies Jennifer Doudna Lab
Genome Editor CasΦ-2 Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies Jennifer Doudna Lab
Genome Editor CasΦ-3 Compact editor of the Cas12j family identified in biggie phage from metagenomic assemblies Jennifer Doudna Lab
Guide Cas12j-GFP10 (CasΦ-3) Guide targeting eGFP compatible with CasΦ-3
Guide Cas12j-GFP14 (CasΦ-3) Guide targeting eGFP compatible with CasΦ-3
Guide Cas12j-GFP15 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP20 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP2 (CasΦ-1) Guide targeting eGFP compatible with CasΦ-1
Guide Cas12j-GFP6 (CasΦ-3) Guide targeting eGFP compatible with CasΦ-3
Guide Cas12j-GFP7 (CasΦ-2) Guide targeting eGFP compatible with CasΦ-2
Guide Cas12j-GFP7 (CasΦ-3) Guide targeting eGFP compatible with CasΦ-3
Guide SapI-GG stuffer (CasΦ-1) Non-targeting guide RNA targeting compatible with CasΦ-1
Vector pPP394 Plasmid containing Homo sapiens codon optimized CasΦ-1 and spacer for editing in human cells. Addgene
Delivery System FSD114d1 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD195 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD238 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Genome Editor SpCas9 (Feldan Therapeutics) Feldan Therapeutics
Delivery System FSD315 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Show Experiments (7)
Guide STS204 (DNMT1; Sp_t2:Sp_c20_Dnmt1) For endogenous locus In house production
Delivery System FSD197 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD63D1 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Delivery System FSD95 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Genome Editor SpCas9 HA-SV40NLS-SpCas9-SV40NLS Vector Encoded
Genome Editor SpyCas9-3xNLS SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal Sontheimer lab
Experiment Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts WT female mouse and homozygous male mouse containing the Gene Editing Reporter 14 (GER14) reporter at the Rosa26 locus were mated. Females were super-ovulated and zygotes harvested. Zyotes were electroporated with various CRISPR/Cas9 combinations (or Cre) and were cultured 96 hours to blastocyst stage. Blastocysts were imaged for Katushka2S (RFP) fluorescence and scored for fluorescence signal. Blastocysts were then PCR amplified for the reporter allele and Sanger sequenced. ICE analysis tool from Synthego was used to score edits. NOTE: Some blasts did not PCR amplify well and it could not be determined if they had edits. Total blasts analyzed expressing the fluorescent reporter, 46-164. Total blast analyzed by Sanger sequencing, 39-142.
Experiment Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles provided from the Gong Lab at the University of Wisconsin-Madison. The Gong lab conducted free radical polymerization of the monomer coating with (PEG)-acrylate to ensure that the RNP-NC be stable and able to conjugate different ligands. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The tri(GalNAc) is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP-NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. The goal was to investigate cellular uptake of Cas9-gRNA nanocapsules using imaging after 24 hours and to determine the appropriate ratio for Lipofectamine-RNP positive control.
Antibody RRID:AB_2536526  GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362
Guide STS159 (mTmG; Sp_t2:Sp_c20_mTmG) This sgRNA targets the mTmG transgene In house production
Experiment Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The triGalNAc is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP-NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. Liver microtissue with a monoculture of primary human hepatocytes (PHH) was used. Each well of the liver-on-a-chip typically is seeded with 6.0 × 10^5 hepatocytes 16 hours prior to the addition of RNP-NCs with flow of 1.0 µl/s through the liver 3D microtissues. Lipofectamine – RNP complex was prepared using Lipofectamine 2000 Transfection Reagent with 1:1 weight to weight ratio after optimization of transfection efficiency. The goal of the experiment was to examine transfection efficiency by testing two doses 2.4 ug and 24 ug RNP-NCs [tri(GalNAc), TAT] with the help of imaging. Transfection of 24µg RNP-NC shows higher uptake when compared to2.4µg RNP-NC.
Experiment Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system Liver-on-a-chip was used to examine the cellular uptake of CRISPR/Cas9 encapsulated nanoparticles. Two liver-targeted ligands were provided from the Gong Lab, RNP-NC attached to tri(GalNAc) and RNP-NC containing cell penetrating peptide (TAT). The triGalNAc is known to enhance RNP-NC target to hepatocytes, whereas TAT will enhance target and uptake of RNP- NC in all liver cells such as Kupffer cells. These ligands are tagged with Atto-550 a fluorescent protein reporter for easier detection. Liver microtissue with a monoculture of primary human hepatocytes (PHH) was used. Each well of the liver-on-a-chip typically is seeded with 6.0 × 10^5 hepatocytes 16 hours prior to the addition of RNP-NCs with flow of 1.0 µl/s through the liver 3D microtissues. Lipofectamine – RNP complex was prepared using Lipofectamine 2000 Transfection Reagent with 1:1 weight to weight ratio after optimization of transfection efficiency. The goal of the experiment was to quantify transfection efficiency by testing two doses 2.4 ug and 24 ug RNP-NCs [tri(GalNAc), TAT] using flow cytometry. Transfection of 24µg RNP-NC shows higher uptake when compared to2.4µg RNP-NC.
Publication Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing. Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attributes benchmarked against AAV serotype 9 as evidenced by robust reporter and therapeutic gene expression, Cre recombination and CRISPR genome editing in normal and diseased mouse models. Enhanced transduction efficiency of AAV.cc47 vectors is further corroborated in macaques and pigs, providing a strong rationale for potential clinical translation into human gene therapies. We envision that ccAAV vectors may not only improve predictive modeling in preclinical studies, but also clinical translatability by broadening the therapeutic window of AAV based gene therapies.
Model System mTmG mouse (congenic) mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. The Jackson Laboratory
Show Experiments (7)
Guide Ai14 gRNA This sgRNA targets the Ai9 and related transgenes at multiple sites IDT
Delivery System RNP-NC-no ligand The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. Gong Lab
Delivery System RNP-NC-CPP The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity Gong Lab
Genome Editor sNLS-SpCas9-sNLS SpCas9 with N- and C-terminal SV40 NLS Aldevron 9212-5MG
Model System Ai9 mouse Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The Jackson Laboratory
Show Experiments (11)
Genome Editor Alt-R™ S.p. Cas9 Nuclease V3 Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. Integrated DNA Technologies (IDT)
Show Experiments (10)