Search Result for Epithelium

Table View
List View

180 results for Epithelium

Cas9 ribonucleoprotein delivery targeted to kidney epithelium Project - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium name : Cas9 ribonucleoprotein delivery targeted to kidney epithelium Wilson Ross C. , Freedman Benjamin S Last Updated Date: 2024-01-16 Show Experiments (1) Podocyte-specific gene editing in human kidney organoids
Podocyte-specific gene editing in human kidney organoids Experiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium Wilson Ross C. , Freedman Benjamin S Last Updated Date: 2024-01-16 Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter. Show Project Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: description : Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium McCray Paul B Last Updated Date: 2020-11-02 Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells. Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
sg298 Guide - [In Vivo, In Vitro] [Mouse] Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium termSynonyms : Ecto-epithelium Epithelium This sgRNA targets the Ai9 and related transgenes at multiple sites Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Podocyte-specific gene editing in human kidney organoids
AAV.pU1a-SpCas9 Vector - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) Vector - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Other Id: Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300 Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Other Id: Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000 Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium McCray Paul B Last Updated Date: 2020-11-02 In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells. Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
SpCas9 Genome Editor - [In Vivo, In Vitro] [Human, Mouse] Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium HA-SV40NLS-SpCas9-SV40NLS Show Experiments (4) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway A novel human T cell platform to define biological adverse effects of genome editing Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Other Id: GFP (D5.1) XP Rabbit mAb antibody Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
Testing AAV5 for activation of tdTomato in mouse airway Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Gao Guang-Ping Last Updated Date: 2020-10-20 AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Alt-R™ S.p. Cas9 Nuclease V3 Genome Editor - [In Vivo, In Vitro] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Ecto-epithelium Columnar epithelium Lung epithelium Epithelium Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. Show Experiments (10) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Validating Gene Editing Reporter 12 (GER12) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for NHEJ in Heterozygous Blastocysts Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 18 (GER18) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 19 (GER19) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for HDR in Heterozygous Blastocysts Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Homozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
S10 Delivery System - [In Vivo, In Vitro] [Human, Mouse, Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Lung epithelium Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (12) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
mTmG mouse (congenic) Model System - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Ecto-epithelium Columnar epithelium Lung epithelium Epithelium mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. Show Experiments (7) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
D10 Delivery System - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Heaney Jason D Last Updated Date: 2021-03-30 AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Gao Validation (Gao, Guang-Ping )
Ai9 mouse (BCM) Model System - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
RRID:AB_2043201 Antibody - [In Vitro] Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium Other Id: Abcam (ab89901) anti-Wilms Tumor-1 (WT1) Show Experiments (1) Podocyte-specific gene editing in human kidney organoids
[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Heaney Jason D Last Updated Date: 2021-09-07 Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - McCray Validation (McCray Jr., Paul)
BCM_ssAAV5-Sp_sgB Guide - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium This sgRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
ssAAV5-spCas9 Vector - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Base Editing in Rhesus Airway Epithelial Project - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Liu David R , Guay David , McCray Paul B , Tarantal Alice F Last Updated Date: 2023-03-15 Show Experiments (7) Rhesus macaque CCR5 gRNA screening using ABE8e-Cas9 Rhesus macaque CCR5 gRNA screening using ABE8e-Cas12a Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Macaca mulatta (Rhesus Macaque) Model System - [In Vivo] [Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
RRID:AB_310759 Antibody - [In Vivo] [Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Other Id: 07-623 T6793 PA5-71680 905501.0 rabbit polyclonal antibody against club cell secretory protein, unconjugated, 07-623, EMD Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
RRID:AB_2717534 Antibody - [In Vivo] [Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Other Id: 07-623 T6793 PA5-71680 905501.0 rabbit polyclonal antibody against the pulmonary-associated surfactant protein C (SPC), unconjugated, PA5-71680, Invitrogen Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
RRID:AB_2565050 Antibody - [In Vivo] [Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Other Id: 07-623 T6793 PA5-71680 905501.0 rabbit polyclonal antibody to detect cytokeratin5+ basal cells, uncojugated, 905501, Biolegend Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway Experiment - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Liu David R , Guay David , McCray Paul B , Tarantal Alice F Last Updated Date: 2023-03-15 We utilized novel amphiphilic shuttle peptides to deliver base editor ribonucleoprotein (RNP) into the airways to edit airway epithelial cells (CCR5 locus) of rhesus monkeys. The Cas9-ABE8e RNP and shuttle peptides S10 or FSD315 were aerosolized into the rhesus monkey trachea. Seven days later, tissues were obtained and dissected, and airway epithelia collected from the trachea, mainstem, and segmental bronchi using cytology brushes. DNA was extracted from epithelial cells and subjected to high-throughput sequencing. Using the FSD315 shuttle peptide and Cas9-ABE8e, we achieved a mean editing efficiency of 2.8% at the CCR5 locus in airway epithelial cells (range 0.02 – 5.3%) depending on the anatomic region sampled. To visualize the biodistribution of the RNPs within the respiratory tract and in specific cell types, we delivered a Cy5-fluorescent peptide fused to a nuclear localization signal (NLS-Cy5) using the S10 peptide. The lungs were obtained 1 and 2 hours post-delivery, fixed, and examined by microscopy. Epifluorescence and confocal microscopy documented an effective intra-nuclear delivery of NLS-Cy5 into epithelial cells throughout the respiratory tract, including large, medium, and small airways, and alveolar regions. Ongoing analyses will identify the NLS-Cy5-positive epithelial cell types using co-localization with fluorescently-labeled antibodies. In summary, using a rhesus monkey model, following a single delivery of adenine base editor RNPs to the airways in a clinically relevant manner we achieved up to 5.3% editing efficiency of the CCR5 locus in airway epithelia, a level considered therapeutically relevant in cystic fibrosis. Show Project Base Editing in Rhesus Airway Epithelial
Antibody - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Other Id: Anti-RFP (RABBIT) Antibody Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
AsCas12a (IDT and Feldan Therapeutics) Genome Editor - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
BALB/c mouse Model System - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
g-loxPbot_C12a Guide - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium This sgRNA targets the Ai9 and related transgenes at two sites Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
sgAi9L Guide - [In Vivo, In Vitro] [Human, Mouse] Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium This sgRNA targets the Ai9 and related transgenes Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
sgAi9R Guide - [In Vivo, In Vitro] [Human, Mouse] Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium This sgRNA targets the Ai9 and related transgenes Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
gRNA #8 Guide - [In Vivo, In Vitro] [Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Show Experiments (2) Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
SaCas9 Genome Editor - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
ssAAV5-sgA+sgB-U1A.GFP Vector - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
ssAAV5-sgB.saCas9 Vector - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
AAV9-Ai9-sgRNA1-CB-SaCas9 Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAVcc47-CMV-SaCas9 Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAVcc47 delivering CMV driven SaCas9 Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
AAVcc47_pTR_self comp 2xU6-Ai9 guides Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Ai9 mouse Model System - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchus termSynonyms : Ecto-epithelium Ciliated epithelium Meso-epithelium Epithelium Endo-epithelium Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Pcsk9 adenine base editor efficiency in liver and nonliver tissue Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium Chaikof Elliot L. Last Updated Date: 2022-04-15 Adenine base editing at the Pcsk9 exon 1 splice donor site in mouse heart, kidney, liver, lungs, muscle, and spleen was assessed one week after systemic administration of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs) in C56BL/6 mice Show Project Delivery Technologies for In Vivo Genome Editing
Pcsk9 Exon 1 splice domain Guide - [In Vivo] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium Pcsk9 Exon 1 splice domain Show Experiments (2) Pcsk9 adenine base editor efficiency in liver and nonliver tissue Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium Heaney Jason D Last Updated Date: 2023-12-18 Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced. Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Chaikof Validation (Chaikof, Elliot L. )
RRID:AB_10563941 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Other Id: Invitrogen, R10367 Polyclonal rabbit anti-RFP antibody Show Experiments (1) Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
AAV4-ZsGreen-Cre Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAV7-ZsGreen-Cre Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
R26-52 Guide - [In Vivo, In Vitro] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (2) Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Murray Stephen A Last Updated Date: 2023-07-18 Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed. Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Gong, Submission 2 (On- and Off-target data)
[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Murray Stephen A Last Updated Date: 2023-07-11 Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed. Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data)
RRID:AB_2813835 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_141607 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
sg298 Guide - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
RNP-NC-CPP Delivery System - [In Vivo, In Vitro] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
RNP-NC-no ligand Delivery System - [In Vivo, In Vitro] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. Show Experiments (4) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
113-O12B Delivery System - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium combinatorial library cationic lipid nanoparticles Show Experiments (2) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
C57BL/6 mouse (Asokan study) Model System - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (2) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2020-11-19 C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
RRID:AB_1196615 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: AB_1196615 GFP (D5.1) XP Rabbit mAb antibody, Cell Signaling Technology Show Experiments (3) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center
[Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Murray Stephen A Last Updated Date: 2023-05-10 Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections. Show Project The Jackson Laboratory Gene Editing Testing Center - Sontheimer Validation (Sontheimer, Eric)
Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain Project - [In Vivo] [Delivery Systems] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Gong Shaoqin (Sarah) Last Updated Date: 2020-10-28 In vivo genome editing using CRISPR/Cas9 is anticipated to be the next wave of therapeutics for various major health threats, including neurodegenerative diseases. However, to date, very few Cas9-gRNA ribonucleoprotein in vivo delivery methods have been reported, and delivery to the brain has been particularly challenging. The unique nanocapsules we plan to develop will ultimately enable high efficiency neuron-targeted genome editing in the brain, thereby offering new hope to treat devastating neurodegenerative diseases. Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
AB_2813835 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: Ab104224 Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 Abcam, Donkey anti-rat alexa fluour 647 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Murray Stephen A Last Updated Date: 2023-05-10 Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice Show Project The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi)
AB_2286684 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: 25-6790 Sc-17320 Sox-2 (Y-17) Antibody, Santa Cruz Biotechnology Show Experiments (1) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
AAV-Pcsk9 Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium Show Experiments (1) On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
B6 Model System - [In Vivo] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium C57BL/6J WT mouse Show Experiments (1) Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
ABE8e Genome Editor - [In Vivo] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium Catalytically impaired Cas fused to TadA deaminase Show Experiments (1) Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
TLR-2 mouse Model System - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways. Show Experiments (1) Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
AAVrh8-ZsGreen-Cre Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
Cre Recombinase dose escalation study in Ai9 mice Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2021-09-16 A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
AAV9-GFP Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/9 self complementary vector expressing GFP driven by CBh promoter Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
AAV9-mCherry Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter Show Experiments (1) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
AAVcc47-mCherry Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter Show Experiments (1) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
AAVcc81-GFP Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
GFP-NLS Genome Editor - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Nuclear targeted GFP Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
g-loxP2_C9 Guide - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium This sgRNA targets the Ai9 and related transgenes Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Antibody - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Other Id: Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200 Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Project - [In Vivo, In Vitro] [Delivery Systems] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium McCray Paul B Last Updated Date: 2020-11-02 The proposed research is relevant to the public health because genetic and acquired diseases affecting the airways pose major disease and economic burdens. By advancing the delivery of gene editing tools, it may be possible to therapeutically modify the cells lining the airways. This novel strategy has implications for the treatment of both monogenetic and acquired lungs disease, and may have applications for other somatic cell therapies. Show Experiments (6) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
mTmG mouse Model System - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Project - [In Vivo, In Vitro] [Delivery Systems] Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Gao Guang-Ping Last Updated Date: 2021-09-21 Efficacy and safety limitations in current gene editing technologies have hindered efforts to treat genetic lung diseases. This proposal seeks to develop and validate a combinatorial delivery approach that uses non-viral and viral vehicles to efficiently transport gene editing tools to disease-relevant cells in the lung. Completion of our work will establish safe and effective delivery vehicles that will guide the design of future gene therapies for genetic disorders. Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Other Id: Anti-RFP (Rabbit) Polyclonal Antibody Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Gao Guang-Ping Last Updated Date: 2021-09-21 AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types. Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
RRID:AB_477585 Antibody - [In Vivo] [Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Other Id: 07-623 T6793 PA5-71680 905501.0 mouse monocolonal antibody against the acetylated α-tubulin, unconjugated, T6793, Sigma-Aldrich Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
BCM_ssAAV5-Sa_sgB Guide - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium This gRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
BCM_ssAAV5-Sp_sgA Guide - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium This sgRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
D237 Delivery System - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
SpCas9 Genome Editor - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Show Experiments (2) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
SpyCas9 g-loxP2_C9 Guide - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium This sgRNA targets the mTmG transgene Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
scAAV5-Cre-GFP Vector - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
ABE8e-Cas9 Genome Editor - [In Vivo, In Vitro] [Human, Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium A-to-G base editor Show Experiments (3) Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
FSD315 Delivery System - [In Vivo, In Vitro] [Human, Mouse, Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (7) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
CleanCap® Fluc Genome Editor - [In Vivo] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium Firefly luciferase mRNA capped using CleanCap. It is polyadenylated, modified with 5-methoxyuridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. Show Experiments (1) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice
Ai9-SauSpyCas9 mouse Model System - [In Vivo] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
SaCas9-Lagor Genome Editor - [In Vivo] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (4) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
AAV9-Ai9-sgRNA2-CB-SaCas9 Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAVcc47-Ai9-sgRNA2-CB-SaCas9 Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice Project - [In Vivo] [Animal Reporter and Testing Center] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Ecto-epithelium Meso-epithelium Lung epithelium Epithelium Endo-epithelium Heaney Jason D Last Updated Date: 2023-12-18 Genome editing systems have the potential to cure some of the most severe human diseases. However, there are significant efficacy and safety issues that must be addressed before this technology can be applied in clinical trials. The BCM-Rice Resource Center for the Analysis of Somatic Gene Editing in Mice will create mouse reporter models for testing genome editing technologies, and to use these animal models to test genome editing delivery technologies and new genome editors developed by other Somatic Cell Genome Editing program members. Show Experiments (5) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Cre recombinase Genome Editor - [In Vivo, In Vitro] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Ecto-epithelium Meso-epithelium Lung epithelium Epithelium Endo-epithelium Cre recombinase delivered by AAV (see vector details) Show Experiments (4) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Cre Recombinase dose escalation study in Ai9 mice Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
RRID:AB_2536526 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: Thermo Fisher Scientific Cat# G10362 Vector Labs Cat# BA-1000 GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362 Show Experiments (3) Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium Chaikof Elliot L. Last Updated Date: 2022-04-15 On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10. Show Project Delivery Technologies for In Vivo Genome Editing
Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium Chen Zheng-Yi Last Updated Date: 2021-04-13 Delivery of firefly luciferase mRNA via new Lipid NanoParticles by tail vein injection into WT C57BL/6J mice targeting the Liver and delivery is measured by luciferase expression. Show Project Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles
AAV5-ZsGreen-Cre Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAV8-ZsGreen-Cre Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAV9-Ai9-sgRNA1 + sgRNA2 Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
AAV9_pTR_self comp 2xU6-Ai9 guides Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
AAVcc47-Ai9-sgRNA1-CB-SaCas9 Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAVcc47-Ai9-sgRNA1 + sgRNA2 Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
CleanCap® Cas9 mRNA (5moU) Genome Editor - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
RRID:AB_2209751 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_10711040 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
C57BL/6J mouse Model System - [In Vivo] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium C57BL/6J WT mouse Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Gong Shaoqin (Sarah) Last Updated Date: 2020-10-28 Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression. Show Project Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
Ai14 mouse Model System - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
AAV Tropism project Experiment - [In Vivo] [AAV tropism] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Lutz Cathleen M , Gao Guang-Ping , Heaney Jason D , Murray Stephen A , Lagor William Raymond , Dickinson Mary E Last Updated Date: 2023-02-10 Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging Show Project SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice
AAV6-ZsGreen-Cre Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
R26-2 Guide - [In Vivo, In Vitro] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (3) Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Homozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Murray Stephen A Last Updated Date: 2024-08-30 Heterozygous embryos containing the traffic light reporter 2 (TLR-2) reporter at the Rosa26 locus were evaluated for activation potential following electroporation of two guide/RNP combinations and transfer to pseudo-pregnant hosts for development to term. Offspring (founders) with activating edits were mated to wild-type females and adult tissues from progeny were assessed for tagRFP fluorescence. Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - TLR2 small animal reporter, submission 2 (Tier 1 & 2 validation)
AAV9-ZsGreen-Cre Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2020-11-19 C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
AB_2209751 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: Ab104224 Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 Anti-RFP (RABBIT) Antibody Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
AB_2532994 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: Ab104224 Rockland Cat# 600-401-379 A21202 A21207 Ab150155 13-0300 Thermo-Fisher, Rat anti-GFAP Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Ai14 gRNA Guide - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium This sgRNA targets the Ai9 and related transgenes at multiple sites Show Experiments (3) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_141637 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
sNLS-SpCas9-sNLS Genome Editor - [In Vivo, In Vitro] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium SpCas9 with N- and C-terminal SV40 NLS Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) Project - [In Vivo, In Vitro] [Animal Reporter and Testing Center] Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium Murray Stephen A Last Updated Date: 2024-08-30 The revolution in gene editing technology promises to transform the development of therapeutics to treat human disease. As part of the Somatic Cell Genome Editing consortium, the goal of this project is to build mouse resources and provide an animal model testing platform to support the optimization of novel genome editing technologies for future translational applications. Show Experiments (18) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain Validating Gene Editing Reporter 12 (GER12) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for NHEJ in Heterozygous Blastocysts Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 18 (GER18) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 19 (GER19) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 10 (GER10) Mouse Model in Heterozygous Blastocysts Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Validating Traffic Light Reporter 7 (TLR7) Mouse Model for HDR in Heterozygous Blastocysts Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Homozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SaCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles Project - [In Vivo, In Vitro] [Delivery Systems] Matched Fields: termSynonyms : Ecto-epithelium Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Chen Zheng-Yi Last Updated Date: 2021-04-13 The proposal is designed to screen lipid nanoparticles as novel materials for RNP (ribonucleoprotein) delivery of editing machinery into the mammalian sensory organ inner ear, to expand the cell types that can be edited to treat genetic hearing loss and to establish a method to perform the study in wildtype large animals. This study has direct relevance to bringing editing based therapy to clinic. Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
Evolving High Potency AAV Vectors for Neuromuscular Genome Editing Project - [In Vivo] [Delivery Systems] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2021-09-16 Recombinant adeno-associated viruses (AAV) have emerged as safe and effective vectors for clinical gene therapy applications including systemic treatment of neuromuscular diseases such as Spinal Muscular Atrophy (SMA), Duchenne Muscular Dystrophy (DMD), and Giant Axonal Neuropathy (GAN) amongst others. However, genome editing in neuromuscular tissue, in particular, is challenging. The current proposal is on a comprehensive and innovative approach to evolve high potency AAV variants for systemic neuromuscular genome editing. Show Experiments (7) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Murray Stephen A Last Updated Date: 2023-05-10 Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice Show Project The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi)
[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Murray Stephen A Last Updated Date: 2023-07-11 Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal. Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data)
Ai9 SaCas9 Guide B Guide - [In Vivo] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium This gRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
AAVcc47-Cre Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/5 expressing Cre recombinase Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System Project - [In Vivo, In Vitro] [Delivery Systems] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Deverman Benjamin E Last Updated Date: 2021-04-17 This project aims to advance the NIH Somatic Cell Genome Editing Program’s objective to identify novel delivery technologies that enable genome editing in therapeutically relevant somatic cell populations. We will use proven virus engineering methods to develop new vehicles that can deliver genome editing machinery throughout the adult mammalian central nervous system. Accomplishing this objective would pave the road for applying gene editing, and gene therapy more broadly, to the study and treatment of neurological and psychiatric disorders. Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
RRID:AB_2313606 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: Thermo Fisher Scientific Cat# G10362 Vector Labs Cat# BA-1000 Vector Labs Goat Anti-Rabbit IgG Biotinylated Cat. #BA-1000 Show Experiments (1) Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Project - [In Vivo, In Vitro] [Delivery Systems] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Sontheimer Erik J Last Updated Date: 2021-10-01 RNA-guided CRISPR genome editing systems promise to revolutionize the treatment of inherited disease. Safe, effective, and target-tissue-specific delivery of the guide RNA that directs editing is a critical hurdle in the development of clinical applications for engineered CRISPR systems. Using strategies validated for the delivery of other categories of nucleic acid therapeutics, we have established a framework for complete chemical modification of CRISPR guides, thereby conferring in vivo stability and effective biodistribution properties. The proposed research will optimize these guides, as well as other editing components, for clinical use. Show Experiments (11) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center
Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Sontheimer Erik J Last Updated Date: 2021-10-01 Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
SpyCas9-3xNLS Genome Editor - [In Vivo, In Vitro] [Human, Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal Show Experiments (7) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
AB_10711040 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: Ab104224 Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 Abcam, mouse anti-NeuN Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
306-O12B blank Delivery System - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Combinatorial library cationic lipid nanoparticles Show Experiments (2) Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
AAV9-CMV-SaCas9 Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering CMV driven SaCas9 Show Experiments (3) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
R2-modified Guide - [In Vivo, In Vitro] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium This gRNA targets the Ai9 and related transgenes Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Delivery Technologies for In Vivo Genome Editing Project - [In Vivo] [Delivery Systems] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium Chaikof Elliot L. Last Updated Date: 2022-04-15 The difficulty of delivering genome editing agents into many types of cells in animals and patients is a major challenge that must be overcome to realize their full potential to cure genetic diseases. We propose to develop two new strategies for the delivery of genome editing agents into animals and patients that will increase editing efficiency, target cell selectivity, and DNA specificity, as well as a new tool to rapidly and sensitively evaluate the delivery of these agents in mice with minimal effort and expense. These developments will advance the safety and efficacy of genome editing methods for clinical development. Show Experiments (2) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
TadA-8e V106W Genome Editor - [In Vivo] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W) Show Experiments (2) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Heaney Jason D Last Updated Date: 2023-05-10 Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Deverman Validation (Deverman, Benjamin)
AAV3b-ZsGreen-Cre Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice Project - [In Vivo] [AAV tropism] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Lutz Cathleen M , Gao Guang-Ping , Heaney Jason D , Murray Stephen A , Lagor William Raymond , Dickinson Mary E Last Updated Date: 2023-02-10 Show Experiments (1) AAV Tropism project
AAVrh10-ZsGreen-Cre Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAVrh74-ZsGreen-Cre Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
eVLP Delivery System - [In Vivo] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium engineered virus like particles Show Experiments (3) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2 Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
AAV9-CMV-Cre Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering CMV Cre Recombinase Show Experiments (1) Cre Recombinase dose escalation study in Ai9 mice
AAVcc47-CMV-Cre Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAVcc47 delivering CMV Cre Recombinase Show Experiments (1) Cre Recombinase dose escalation study in Ai9 mice
RRID:AB_2532994 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RNP-NC-RVG Delivery System - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry Show Experiments (2) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Deverman Benjamin E Last Updated Date: 2021-04-17 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later. Show Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System
306-O12B Delivery System - [In Vivo, In Vitro] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Combinatorial library cationic lipid nanoparticles Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
306-S10 Delivery System - [In Vivo, In Vitro] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium combinatorial library cationic lipid nanoparticles Show Experiments (5) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
AAV Delivery System - [In Vivo, In Vitro] [Human, Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium See vector details Show Experiments (9) Cre Recombinase dose escalation study in Ai9 mice AAV Tropism project AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids. Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
AAVcc84-GFP Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Ai14 mouse (congenic) Model System - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium Heaney Jason D Last Updated Date: 2021-03-30 Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues. Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Asokan Validation (Asokan, Aravind)
Ai9 SaCas9 Guide A Guide - [In Vivo] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium This gRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
SauCas9 Genome Editor - [In Vivo] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
AAVcc47-SaCas9-Ai9 Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
SaCas9 Genome Editor - [In Vivo, In Vitro] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
L1-modified Guide - [In Vivo, In Vitro] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium This gRNA targets the Ai9 and related transgenes Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
AB_10015251 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: 25-6790 Sc-17320 Anti-Myosin VIIa antibody, Proteus Biosciences Show Experiments (1) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
CleanCap® Cas9 Genome Editor - [In Vivo, In Vitro] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. Show Experiments (2) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
STS159 (mTmG; Sp_t2:Sp_c20_mTmG) Guide - [In Vivo, In Vitro] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium This sgRNA targets the mTmG transgene Show Experiments (4) Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
STS204 (DNMT1; Sp_t2:Sp_c20_Dnmt1) Guide - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium For endogenous locus Show Experiments (2) Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
AB_141637 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: Ab104224 Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 Invitrogen, Donkey anti-rabbit alexa fluor 594 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
AB_141607 Antibody - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: Ab104224 Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 Invitrogen, Donkey anti-mouse alexafluor 488 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Murray Stephen A Last Updated Date: 2023-05-10 Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice Show Project The Jackson Laboratory Gene Editing Testing Center - Gong Validation (Gong, Shaoqin)
L2-modified Guide - [In Vivo, In Vitro] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium This gRNA targets the Ai9 and related transgenes Show Experiments (2) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
BI28:AAV-GFAP-SaCas9-WPRE3-pA Vector - [In Vivo] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Chen Zheng-Yi Last Updated Date: 2021-04-13 Delivery of Cas9/sgRNA mRNA via new LNPs to the cochlea by cochleostomy and gene editing is measured by percentage of tdTomato positive cells. Show Project Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles

180 results for Epithelium

Category	Name	Description	Source	View Associated...
Project	Cas9 ribonucleoprotein delivery targeted to kidney epithelium			Show Experiments (1) Podocyte-specific gene editing in human kidney organoids
Experiment	Podocyte-specific gene editing in human kidney organoids	Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter.		Show Project Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Experiment	Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.	Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells.		Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Guide	sg298	This sgRNA targets the Ai9 and related transgenes at multiple sites	Synthego	Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Podocyte-specific gene editing in human kidney organoids
Vector	AAV.pU1a-SpCas9	Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS	Addgene	Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Vector	H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)	AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP	Gao Lab	Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody		Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody		Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Experiment	Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia	In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells.		Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Genome Editor	SpCas9	HA-SV40NLS-SpCas9-SV40NLS	Vector Encoded	Show Experiments (4) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway A novel human T cell platform to define biological adverse effects of genome editing Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody		GFP (D5.1) XP Rabbit mAb antibody		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
Experiment	Testing AAV5 for activation of tdTomato in mouse airway	AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation		Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Genome Editor	Alt-R™ S.p. Cas9 Nuclease V3	Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol.	Integrated DNA Technologies (IDT)	Show Experiments (10) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Validating Gene Editing Reporter 12 (GER12) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for NHEJ in Heterozygous Blastocysts Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 18 (GER18) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 19 (GER19) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for HDR in Heterozygous Blastocysts Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Homozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
Delivery System	S10	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (12) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Model System	mTmG mouse (congenic)	mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed.	The Jackson Laboratory	Show Experiments (7) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Delivery System	D10		McCray Lab	Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Experiment	[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice	AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Gao Validation (Gao, Guang-Ping )
Model System	Ai9 mouse (BCM)	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	Baylor College of Medicine	Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Antibody	RRID:AB_2043201	anti-Wilms Tumor-1 (WT1)		Show Experiments (1) Podocyte-specific gene editing in human kidney organoids
Experiment	[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides	Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - McCray Validation (McCray Jr., Paul)
Guide	BCM_ssAAV5-Sp_sgB	This sgRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Vector	ssAAV5-spCas9		Gao Lab	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Project	Base Editing in Rhesus Airway Epithelial			Show Experiments (7) Rhesus macaque CCR5 gRNA screening using ABE8e-Cas9 Rhesus macaque CCR5 gRNA screening using ABE8e-Cas12a Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Model System	Macaca mulatta (Rhesus Macaque)		Tarantal Lab	Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Antibody	RRID:AB_310759	rabbit polyclonal antibody against club cell secretory protein, unconjugated, 07-623, EMD		Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Antibody	RRID:AB_2717534	rabbit polyclonal antibody against the pulmonary-associated surfactant protein C (SPC), unconjugated, PA5-71680, Invitrogen		Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Antibody	RRID:AB_2565050	rabbit polyclonal antibody to detect cytokeratin5+ basal cells, uncojugated, 905501, Biolegend		Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Experiment	Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway	We utilized novel amphiphilic shuttle peptides to deliver base editor ribonucleoprotein (RNP) into the airways to edit airway epithelial cells (CCR5 locus) of rhesus monkeys. The Cas9-ABE8e RNP and shuttle peptides S10 or FSD315 were aerosolized into the rhesus monkey trachea. Seven days later, tissues were obtained and dissected, and airway epithelia collected from the trachea, mainstem, and segmental bronchi using cytology brushes. DNA was extracted from epithelial cells and subjected to high-throughput sequencing. Using the FSD315 shuttle peptide and Cas9-ABE8e, we achieved a mean editing efficiency of 2.8% at the CCR5 locus in airway epithelial cells (range 0.02 – 5.3%) depending on the anatomic region sampled. To visualize the biodistribution of the RNPs within the respiratory tract and in specific cell types, we delivered a Cy5-fluorescent peptide fused to a nuclear localization signal (NLS-Cy5) using the S10 peptide. The lungs were obtained 1 and 2 hours post-delivery, fixed, and examined by microscopy. Epifluorescence and confocal microscopy documented an effective intra-nuclear delivery of NLS-Cy5 into epithelial cells throughout the respiratory tract, including large, medium, and small airways, and alveolar regions. Ongoing analyses will identify the NLS-Cy5-positive epithelial cell types using co-localization with fluorescently-labeled antibodies. In summary, using a rhesus monkey model, following a single delivery of adenine base editor RNPs to the airways in a clinically relevant manner we achieved up to 5.3% editing efficiency of the CCR5 locus in airway epithelia, a level considered therapeutically relevant in cystic fibrosis.		Show Project Base Editing in Rhesus Airway Epithelial
Antibody		Anti-RFP (RABBIT) Antibody		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
Genome Editor	AsCas12a (IDT and Feldan Therapeutics)		IDT and Feldan Therapeutics	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Model System	BALB/c mouse	BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO).	The Jackson Laboratory	Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
Guide	g-loxPbot_C12a	This sgRNA targets the Ai9 and related transgenes at two sites	IDT	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Guide	sgAi9L	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Guide	sgAi9R	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Guide	gRNA #8		IDT	Show Experiments (2) Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Genome Editor	SaCas9		Vector Encoded (ssaav5-sga+sgb-u1a.gfp)	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Vector	ssAAV5-sgA+sgB-U1A.GFP		Gao Lab	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Vector	ssAAV5-sgB.saCas9		Gao Lab	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Vector	AAV9-Ai9-sgRNA1-CB-SaCas9	AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAVcc47-CMV-SaCas9	AAVcc47 delivering CMV driven SaCas9	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Vector	AAVcc47_pTR_self comp 2xU6-Ai9 guides	AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Model System	Ai9 mouse	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	The Jackson Laboratory	Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Experiment	Pcsk9 adenine base editor efficiency in liver and nonliver tissue	Adenine base editing at the Pcsk9 exon 1 splice donor site in mouse heart, kidney, liver, lungs, muscle, and spleen was assessed one week after systemic administration of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs) in C56BL/6 mice		Show Project Delivery Technologies for In Vivo Genome Editing
Guide	Pcsk9 Exon 1 splice domain	Pcsk9 Exon 1 splice domain	Synthego	Show Experiments (2) Pcsk9 adenine base editor efficiency in liver and nonliver tissue Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Experiment	[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver	Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced.		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Chaikof Validation (Chaikof, Elliot L. )
Antibody	RRID:AB_10563941	Polyclonal rabbit anti-RFP antibody		Show Experiments (1) Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
Vector	AAV4-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAV7-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Guide	R26-52		IDT	Show Experiments (2) Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
Experiment	[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain	Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed.		Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Gong, Submission 2 (On- and Off-target data)
Experiment	[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear	Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed.		Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data)
Antibody	RRID:AB_2813835			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_141607			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Guide	sg298	This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases	Synthego	Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Delivery System	RNP-NC-CPP	The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity	Gong Lab	Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Delivery System	RNP-NC-no ligand	The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA.	Gong Lab	Show Experiments (4) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Delivery System	113-O12B	combinatorial library cationic lipid nanoparticles	Xu lab	Show Experiments (2) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
Model System	C57BL/6 mouse (Asokan study)		Unspecified	Show Experiments (2) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Experiment	Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.	C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Antibody	RRID:AB_1196615	GFP (D5.1) XP Rabbit mAb antibody, Cell Signaling Technology		Show Experiments (3) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center
Experiment	[Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain	Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections.		Show Project The Jackson Laboratory Gene Editing Testing Center - Sontheimer Validation (Sontheimer, Eric)
Project	Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain	In vivo genome editing using CRISPR/Cas9 is anticipated to be the next wave of therapeutics for various major health threats, including neurodegenerative diseases. However, to date, very few Cas9-gRNA ribonucleoprotein in vivo delivery methods have been reported, and delivery to the brain has been particularly challenging. The unique nanocapsules we plan to develop will ultimately enable high efficiency neuron-targeted genome editing in the brain, thereby offering new hope to treat devastating neurodegenerative diseases.		Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Antibody	AB_2813835	Abcam, Donkey anti-rat alexa fluour 647		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Experiment	[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear	Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice		Show Project The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi)
Antibody	AB_2286684	Sox-2 (Y-17) Antibody, Santa Cruz Biotechnology		Show Experiments (1) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
Vector	AAV-Pcsk9			Show Experiments (1) On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Model System	B6	C57BL/6J WT mouse	Baylor College of Medicine	Show Experiments (1) Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Genome Editor	ABE8e	Catalytically impaired Cas fused to TadA deaminase	Liu Lab	Show Experiments (1) Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Model System	TLR-2 mouse	R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways.	The Jackson Laboratory	Show Experiments (1) Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
Vector	AAVrh8-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Experiment	Cre Recombinase dose escalation study in Ai9 mice	A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Vector	AAV9-GFP	AAV2/9 self complementary vector expressing GFP driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Vector	AAV9-mCherry	AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Vector	AAVcc47-mCherry	AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Vector	AAVcc81-GFP	AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Genome Editor	GFP-NLS	Nuclear targeted GFP	Expressed From (Escherichia coli BL21DE3)	Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
Guide	g-loxP2_C9	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Antibody		Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Project	Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides	The proposed research is relevant to the public health because genetic and acquired diseases affecting the airways pose major disease and economic burdens. By advancing the delivery of gene editing tools, it may be possible to therapeutically modify the cells lining the airways. This novel strategy has implications for the treatment of both monogenetic and acquired lungs disease, and may have applications for other somatic cell therapies.		Show Experiments (6) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells.
Model System	mTmG mouse	ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence	The Jackson Laboratory	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Project	Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases	Efficacy and safety limitations in current gene editing technologies have hindered efforts to treat genetic lung diseases. This proposal seeks to develop and validate a combinatorial delivery approach that uses non-viral and viral vehicles to efficiently transport gene editing tools to disease-relevant cells in the lung. Completion of our work will establish safe and effective delivery vehicles that will guide the design of future gene therapies for genetic disorders.		Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody		Anti-RFP (Rabbit) Polyclonal Antibody		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Experiment	Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells	AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.		Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Antibody	RRID:AB_477585	mouse monocolonal antibody against the acetylated α-tubulin, unconjugated, T6793, Sigma-Aldrich		Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Guide	BCM_ssAAV5-Sa_sgB	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Guide	BCM_ssAAV5-Sp_sgA	This sgRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Delivery System	D237		McCray Lab	Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Genome Editor	SpCas9		IDT	Show Experiments (2) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Guide	SpyCas9 g-loxP2_C9	This sgRNA targets the mTmG transgene	IDT	Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Vector	scAAV5-Cre-GFP		Gao Lab	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Genome Editor	ABE8e-Cas9	A-to-G base editor	Feldan Therapeutics	Show Experiments (3) Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Delivery System	FSD315	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (7) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Genome Editor	CleanCap® Fluc	Firefly luciferase mRNA capped using CleanCap. It is polyadenylated, modified with 5-methoxyuridine and optimized for mammalian systems. It mimics a fully processed mature mRNA.	Trilink Biotechnologies	Show Experiments (1) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice
Model System	Ai9-SauSpyCas9 mouse	Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.	Baylor College of Medicine	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.	A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Experiment	Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)	A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Genome Editor	SaCas9-Lagor		William Lagor, Baylor College Of Medicine	Show Experiments (4) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Vector	AAV9-Ai9-sgRNA2-CB-SaCas9	AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAVcc47-Ai9-sgRNA2-CB-SaCas9	AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Project	BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice	Genome editing systems have the potential to cure some of the most severe human diseases. However, there are significant efficacy and safety issues that must be addressed before this technology can be applied in clinical trials. The BCM-Rice Resource Center for the Analysis of Somatic Gene Editing in Mice will create mouse reporter models for testing genome editing technologies, and to use these animal models to test genome editing delivery technologies and new genome editors developed by other Somatic Cell Genome Editing program members.		Show Experiments (5) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Genome Editor	Cre recombinase	Cre recombinase delivered by AAV (see vector details)		Show Experiments (4) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Cre Recombinase dose escalation study in Ai9 mice Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Antibody	RRID:AB_2536526	GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362		Show Experiments (3) Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Experiment	On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver	On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10.		Show Project Delivery Technologies for In Vivo Genome Editing
Experiment	Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice	Delivery of firefly luciferase mRNA via new Lipid NanoParticles by tail vein injection into WT C57BL/6J mice targeting the Liver and delivery is measured by luciferase expression.		Show Project Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles
Vector	AAV5-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAV8-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAV9-Ai9-sgRNA1 + sgRNA2	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Vector	AAV9_pTR_self comp 2xU6-Ai9 guides	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Vector	AAVcc47-Ai9-sgRNA1-CB-SaCas9	AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAVcc47-Ai9-sgRNA1 + sgRNA2	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Genome Editor	CleanCap® Cas9 mRNA (5moU)	SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA.	Trilink Biotechnologies	Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Antibody	RRID:AB_2209751			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_10711040			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Model System	C57BL/6J mouse	C57BL/6J WT mouse	The Jackson Laboratory	Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Experiment	Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.	Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression.		Show Project Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
Model System	Ai14 mouse	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Experiment	AAV Tropism project	Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging		Show Project SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice
Vector	AAV6-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Guide	R26-2		IDT	Show Experiments (3) Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Homozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
Experiment	Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing	Heterozygous embryos containing the traffic light reporter 2 (TLR-2) reporter at the Rosa26 locus were evaluated for activation potential following electroporation of two guide/RNP combinations and transfer to pseudo-pregnant hosts for development to term. Offspring (founders) with activating edits were mated to wild-type females and adult tissues from progeny were assessed for tagRFP fluorescence.		Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - TLR2 small animal reporter, submission 2 (Tier 1 & 2 validation)
Vector	AAV9-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Experiment	Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.	C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Antibody	AB_2209751	Anti-RFP (RABBIT) Antibody		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	AB_2532994	Thermo-Fisher, Rat anti-GFAP		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Guide	Ai14 gRNA	This sgRNA targets the Ai9 and related transgenes at multiple sites	IDT	Show Experiments (3) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_141637			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Genome Editor	sNLS-SpCas9-sNLS	SpCas9 with N- and C-terminal SV40 NLS	Aldevron 9212-5MG	Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Project	The Jackson Laboratory Gene Editing Testing Center (JAX-GETC)	The revolution in gene editing technology promises to transform the development of therapeutics to treat human disease. As part of the Somatic Cell Genome Editing consortium, the goal of this project is to build mouse resources and provide an animal model testing platform to support the optimization of novel genome editing technologies for future translational applications.		Show Experiments (18) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain Validating Gene Editing Reporter 12 (GER12) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for NHEJ in Heterozygous Blastocysts Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 18 (GER18) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 19 (GER19) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 10 (GER10) Mouse Model in Heterozygous Blastocysts Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Validating Traffic Light Reporter 7 (TLR7) Mouse Model for HDR in Heterozygous Blastocysts Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Homozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SaCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
Project	Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles	The proposal is designed to screen lipid nanoparticles as novel materials for RNP (ribonucleoprotein) delivery of editing machinery into the mammalian sensory organ inner ear, to expand the cell types that can be edited to treat genetic hearing loss and to establish a method to perform the study in wildtype large animals. This study has direct relevance to bringing editing based therapy to clinic.		Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
Project	Evolving High Potency AAV Vectors for Neuromuscular Genome Editing	Recombinant adeno-associated viruses (AAV) have emerged as safe and effective vectors for clinical gene therapy applications including systemic treatment of neuromuscular diseases such as Spinal Muscular Atrophy (SMA), Duchenne Muscular Dystrophy (DMD), and Giant Axonal Neuropathy (GAN) amongst others. However, genome editing in neuromuscular tissue, in particular, is challenging. The current proposal is on a comprehensive and innovative approach to evolve high potency AAV variants for systemic neuromuscular genome editing.		Show Experiments (7) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Experiment	[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear	Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice		Show Project The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi)
Experiment	[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear	Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal.		Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data)
Guide	Ai9 SaCas9 Guide B	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Vector	AAVcc47-Cre	AAV2/5 expressing Cre recombinase	Asokan Lab	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Project	Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System	This project aims to advance the NIH Somatic Cell Genome Editing Program’s objective to identify novel delivery technologies that enable genome editing in therapeutically relevant somatic cell populations. We will use proven virus engineering methods to develop new vehicles that can deliver genome editing machinery throughout the adult mammalian central nervous system. Accomplishing this objective would pave the road for applying gene editing, and gene therapy more broadly, to the study and treatment of neurological and psychiatric disorders.		Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Antibody	RRID:AB_2313606	Vector Labs Goat Anti-Rabbit IgG Biotinylated Cat. #BA-1000		Show Experiments (1) Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Project	Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors	RNA-guided CRISPR genome editing systems promise to revolutionize the treatment of inherited disease. Safe, effective, and target-tissue-specific delivery of the guide RNA that directs editing is a critical hurdle in the development of clinical applications for engineered CRISPR systems. Using strategies validated for the delivery of other categories of nucleic acid therapeutics, we have established a framework for complete chemical modification of CRISPR guides, thereby conferring in vivo stability and effective biodistribution properties. The proposed research will optimize these guides, as well as other editing components, for clinical use.		Show Experiments (11) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center
Experiment	Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center	Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain		Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Genome Editor	SpyCas9-3xNLS	SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal	Sontheimer lab	Show Experiments (7) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Antibody	AB_10711040	Abcam, mouse anti-NeuN		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Delivery System	306-O12B blank	Combinatorial library cationic lipid nanoparticles	Xu lab	Show Experiments (2) Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)	A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)	A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Vector	AAV9-CMV-SaCas9	AAV serotype 9 delivering CMV driven SaCas9	Asokan Lab	Show Experiments (3) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Guide	R2-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Project	Delivery Technologies for In Vivo Genome Editing	The difficulty of delivering genome editing agents into many types of cells in animals and patients is a major challenge that must be overcome to realize their full potential to cure genetic diseases. We propose to develop two new strategies for the delivery of genome editing agents into animals and patients that will increase editing efficiency, target cell selectivity, and DNA specificity, as well as a new tool to rapidly and sensitively evaluate the delivery of these agents in mice with minimal effort and expense. These developments will advance the safety and efficacy of genome editing methods for clinical development.		Show Experiments (2) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Genome Editor	TadA-8e V106W	Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W)	Chaikof Lab	Show Experiments (2) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Experiment	[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain	Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Deverman Validation (Deverman, Benjamin)
Vector	AAV3b-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Project	SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice			Show Experiments (1) AAV Tropism project
Vector	AAVrh10-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAVrh74-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Delivery System	eVLP	engineered virus like particles	Liu Lab	Show Experiments (3) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Vector	BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2	Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds	Deverman Lab	Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Vector	AAV9-CMV-Cre	AAV serotype 9 delivering CMV Cre Recombinase	Asokan Lab	Show Experiments (1) Cre Recombinase dose escalation study in Ai9 mice
Vector	AAVcc47-CMV-Cre	AAVcc47 delivering CMV Cre Recombinase	Asokan Lab	Show Experiments (1) Cre Recombinase dose escalation study in Ai9 mice
Antibody	RRID:AB_2532994			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Delivery System	RNP-NC-RVG	The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry	Gong Lab	Show Experiments (2) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Experiment	Testing gRNA sequence and gRNA scaffold modified in Ai9 mice.	3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later.		Show Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System
Delivery System	306-O12B	Combinatorial library cationic lipid nanoparticles	Xu lab	Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Delivery System	306-S10	combinatorial library cationic lipid nanoparticles	Xu lab	Show Experiments (5) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Delivery System	AAV	See vector details		Show Experiments (9) Cre Recombinase dose escalation study in Ai9 mice AAV Tropism project AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids. Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Vector	AAVcc84-GFP	AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Model System	Ai14 mouse (congenic)	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Experiment	[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.	Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Asokan Validation (Asokan, Aravind)
Guide	Ai9 SaCas9 Guide A	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Genome Editor	SauCas9			Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Vector	AAVcc47-SaCas9-Ai9	AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter	Asokan Lab	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Genome Editor	SaCas9			Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Guide	L1-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Antibody	AB_10015251	Anti-Myosin VIIa antibody, Proteus Biosciences		Show Experiments (1) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
Genome Editor	CleanCap® Cas9	SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA.	Trilink Biotechnologies	Show Experiments (2) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
Guide	STS159 (mTmG; Sp_t2:Sp_c20_mTmG)	This sgRNA targets the mTmG transgene	In house production	Show Experiments (4) Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Guide	STS204 (DNMT1; Sp_t2:Sp_c20_Dnmt1)	For endogenous locus	In house production	Show Experiments (2) Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Antibody	AB_141637	Invitrogen, Donkey anti-rabbit alexa fluor 594		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	AB_141607	Invitrogen, Donkey anti-mouse alexafluor 488		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Experiment	[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain	Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice		Show Project The Jackson Laboratory Gene Editing Testing Center - Gong Validation (Gong, Shaoqin)
Guide	L2-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (2) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Vector	BI28:AAV-GFAP-SaCas9-WPRE3-pA	Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter	Deverman Lab	Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Experiment	Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea	Delivery of Cas9/sgRNA mRNA via new LNPs to the cochlea by cochleostomy and gene editing is measured by percentage of tdTomato positive cells.		Show Project Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles

Contact SCGE

180 results for Epithelium

Select Category

OR Filter By ...

180 results for Epithelium

[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

RRID:AB_2043201

[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides

RRID:AB_310759

RRID:AB_2717534

RRID:AB_2565050

[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver

RRID:AB_10563941

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

RRID:AB_2813835

RRID:AB_141607

RRID:AB_1196615

[Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain

AB_2813835

[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

AB_2286684

RRID:AB_477585

RRID:AB_2536526

RRID:AB_2209751

RRID:AB_10711040

AB_2209751

AB_2532994

RRID:AB_141637

[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

RRID:AB_2313606

AB_10711040