193 results for Epithelium

Cas9 ribonucleoprotein delivery targeted to kidney epithelium

Project  [Delivery Systems, Collaborative Opportunity Fund, Biological Effects]
Matched Fields: name : Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Wilson Ross C. , Freedman Benjamin S  Last Updated Date: 2024-01-16
 

Podocyte-specific gene editing in human kidney organoids

Experiment  - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects]
Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Wilson Ross C. , Freedman Benjamin S  Last Updated Date: 2024-01-16
 
Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter.

Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: description : Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
McCray Paul B  Last Updated Date: 2020-11-02
 
Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells.

g-loxP2_C9

Guide  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
This sgRNA targets the Ai9 and related transgenes

sgAi9L

Guide  - [In Vivo, In Vitro] [Delivery Systems] [Human, Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
This sgRNA targets the Ai9 and related transgenes

Antibody  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Other Id:
Anti-RFP (Rabbit) Polyclonal Antibody

BALB/c mouse

Model System  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO).

SaCas9

Genome Editor  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Lung epithelium

Antibody  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Other Id:
GFP (D5.1) XP Rabbit mAb antibody

RRID:AB_310759 

Antibody  - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium
Other Id: RRID:AB_310759 07-623
rabbit polyclonal antibody against club cell secretory protein, unconjugated, 07-623, EMD

Alt-R® S.p. Cas9 Nuclease V3

Genome Editor  - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Ecto-epithelium Columnar epithelium Lung epithelium Epithelium
Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol.

mTmG mouse

Model System  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence

ssAAV5-sgB.saCas9

Vector  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Lung epithelium

BCM_ssAAV5-Sa_sgB

Guide  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Lung epithelium
This gRNA targets the Ai9 and related transgenes

Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Gao Guang-Ping  Last Updated Date: 2021-09-21
 
AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.

Antibody  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Other Id:
Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300

S10

Delivery System  - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Mouse, Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Lung epithelium
Shuttle peptide used to deliver reagents to airway epithelia
Show Experiments (12)

ssAAV5-sgA+sgB-U1A.GFP

Vector  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium

BCM_ssAAV5-Sp_sgA

Guide  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
This sgRNA targets the Ai9 and related transgenes

Heaney-SATC_McCray-Validation_Intranasal Instillation in Mice Protocol

Protocol  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
Procedure for intranasal instillation of ribonucleoprotein/peptide complex in mice for delivery to the lung.

RRID:AB_2565050 

Antibody  - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium
Other Id: 905501.0 RRID:AB_2565050
rabbit polyclonal antibody to detect cytokeratin5+ basal cells, uncojugated, 905501, Biolegend

D237

Delivery System  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium

ssAAV5-spCas9

Vector  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium

SpyCas9 g-loxP2_C9

Guide  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
This sgRNA targets the mTmG transgene

Ai9 mouse (BCM)

Model System  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.

Heaney-SATC_McCray-Validation_Lung Inflation and Fixation Protocol

Protocol  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
Procedure for mouse lung inflation and fixation.

SpCas9

Genome Editor  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium

Heaney-SATC_Gao-Validation_Intratracheal Delivery of AAV in Mice

Protocol  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
Procedure for Intratracheal (IT) delivery of AAV in mouse lung.

Ai9-SauSpyCas9 mouse

Model System  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.

RRID:AB_2043201 

Antibody  - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects]
Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Other Id: RRID:AB_2043201 Abcam (ab89901)
anti-Wilms Tumor-1 (WT1)

Macaca mulatta (Rhesus Macaque)

Model System  - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium

sg298

Guide  - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] [Mouse]
Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium termSynonyms : Ecto-epithelium Epithelium
This sgRNA targets the Ai9 and related transgenes at multiple sites

Testing AAV5 for activation of tdTomato in mouse airway

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Gao Guang-Ping  Last Updated Date: 2020-10-20
 
AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation

Antibody  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Other Id:
Anti-RFP (RABBIT) Antibody

Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
McCray Paul B  Last Updated Date: 2020-11-02
 
In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells.

AsCas12a (IDT and Feldan Therapeutics)

Genome Editor  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium

g-loxPbot_C12a

Guide  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
This sgRNA targets the Ai9 and related transgenes at two sites

scAAV5-Cre-GFP

Vector  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Lung epithelium

SpCas9

Genome Editor  - [In Vivo, In Vitro] [Delivery Systems, Biological Effects] [Human, Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
HA-SV40NLS-SpCas9-SV40NLS

AAV.pU1a-SpCas9

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS

sgAi9R

Guide  - [In Vivo, In Vitro] [Delivery Systems] [Human, Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
This sgRNA targets the Ai9 and related transgenes

Antibody  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Other Id:
Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000

RRID:AB_477585 

Antibody  - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium
Other Id: RRID:AB_477585 T6793
mouse monocolonal antibody against the acetylated α-tubulin, unconjugated, T6793, Sigma-Aldrich

[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
Heaney Jason D  Last Updated Date: 2021-09-07
 
Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings

D10

Delivery System  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium

Heaney_SATC Tissue Processing, Imaging and Analysis

Protocol  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Ecto-epithelium Meso-epithelium Lung epithelium Epithelium Endo-epithelium
Procedure for tissue preparation, imaging and analysis.

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2021-09-16
 
A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

AAV9_pTR_self comp 2xU6-Ai9 guides

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene

AAVcc47-Ai9-sgRNA2-CB-SaCas9

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus

Chaikof-Associated Protocol 1_Retro-orbital administration and High throughput sequencing

Protocol  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
This Protocol describes in vivo administration of BE-eVLP for Pcsk9 knockdown in liver, including sequencing endpoint.

[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
Heaney Jason D  Last Updated Date: 2023-12-18
 
Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced.

ABE8e

Genome Editor  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
Catalytically impaired Cas fused to TadA deaminase

eVLP

Delivery System  - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
engineered virus like particles

AAV7-ZsGreen-Cre

Vector  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAV8-ZsGreen-Cre

Vector  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

sNLS-SpCas9-sNLS

Genome Editor  - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
SpCas9 with N- and C-terminal SV40 NLS

sg298

Guide  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases

RRID:AB_2762843 

Antibody  [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Other Id: Invitrogen Product # A32931 RRID:AB_2762843
Goat anti-chicken IgG-Alexa Fluor 488

113-O12B

Delivery System  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium
combinatorial library cationic lipid nanoparticles

Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2020-11-19
 
C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.

Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2020-11-19
 
C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.

AAV9-GFP

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/9 self complementary vector expressing GFP driven by CBh promoter

306-S10

Delivery System  - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
combinatorial library cationic lipid nanoparticles

ABE8e-Cas9

Genome Editor  - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Rhesus macaque]
Matched Fields: termSynonyms : Digestive tract epithelium Epithelium Endo-epithelium Unilaminar epithelium Foregut epithelium
A-to-G base editor

Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium
Chen Zheng-Yi  Last Updated Date: 2021-04-13
 
Delivery of firefly luciferase mRNA via new Lipid NanoParticles by tail vein injection into WT C57BL/6J mice targeting the Liver and delivery is measured by luciferase expression.

CleanCap® Fluc

Genome Editor  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium
Firefly luciferase mRNA capped using CleanCap. It is polyadenylated, modified with 5-methoxyuridine and optimized for mammalian systems. It mimics a fully processed mature mRNA.

AAV9-Ai9-sgRNA1-CB-SaCas9

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus

ABE8e

Genome Editor  - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Mouse, Rhesus macaque]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium
Tad8e deaminase fused to a nickase (D10A) spCas9

70. Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins.

Publication  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
Banskota S, Raguram A, Suh S, Du SW, Davis JR, Choi EH, Wang X, Nielsen SC, Newby GA, Randolph PB, Osborn MJ, Musunuru K, Palczewski K, Liu DR
PII: S0092-8674(21)01484-7, PUBMED 35021064, PMC PMC8809250, DOI 10.1016/j.cell.2021.12.021

ABSTRACT: Methods to deliver gene editing agents in vivo as ribonucleoproteins could offer safety advantages over nucleic acid delivery approaches. We report the development and application of engineered DNA-free virus-like particles (eVLPs) that efficiently package and deliver base editor or Cas9 ribonucleoproteins. By engineering VLPs to overcome cargo packaging, release, and localization bottlenecks, we developed fourth-generation eVLPs that mediate efficient base editing in several primary mouse and h ...
SCGE data tags...

C57BL/6J mouse

Model System  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
C57BL/6J WT mouse

SpyCas9-3xNLS

Genome Editor  - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Human, Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal

AAV3b-ZsGreen-Cre

Vector  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAVrh10-ZsGreen-Cre

Vector  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

demo VV02-Cre

Vector  [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
DEMO viral vector for demo purpose

Cre Recombinase dose escalation study in Ai9 mice

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2021-09-16
 
A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images.

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Murray Stephen A  Last Updated Date: 2023-07-18
 
Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed.

Ai14 gRNA

Guide  - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
This sgRNA targets the Ai9 and related transgenes at multiple sites

RRID:AB_2633281 

Antibody  [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Other Id: RRID:AB_2633281 Invitrogen Product #A32732
Goat anti-rabbit IgG-Alexa Fluor 555

RRID:AB_2209751 

Antibody  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Other Id: RRID:AB_2209751

RRID:AB_141637 

Antibody  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Other Id: RRID:AB_141637

[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium
Heaney Jason D  Last Updated Date: 2021-03-30
 
Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.

Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Gong Shaoqin (Sarah)  Last Updated Date: 2020-10-28
 
Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression.

Murray-SATC_Gong-Validaiton_Gong Study Protocol

Protocol  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Procedure for intracranial injection, immunofluorescence and imaging.

AB_2209751 

Antibody  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: Rockland Cat# 600-401-379 AB_2209751
Anti-RFP (RABBIT) Antibody

[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Murray Stephen A  Last Updated Date: 2023-05-10
 
Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice

Gong_Intracranial Injection Procedure for Mice

Protocol  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Procedure for intracranial delivery to mouse brain.

AB_2813835 

Antibody  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: ab150155 AB_2813835
Abcam, Donkey anti-rat alexa fluour 647

AB_141607 

Antibody  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: AB_141607 A21202
Invitrogen, Donkey anti-mouse alexafluor 488

R2-modified

Guide  - [In Vivo, In Vitro] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
This gRNA targets the Ai9 and related transgenes

Deverman_Comprehensive Methods

Protocol  - [In Vivo, In Vitro] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Procedure for plasmid cloning, editing evaluation in fibroblast, AAV production and administration, tissue processing and IHC.

Deverman_Area Based Quantification of Editing Efficiency Protocol

Protocol  - [In Vivo, In Vitro] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Procedure for non-IHC based image quantification of editing.

L1-modified

Guide  - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
This gRNA targets the Ai9 and related transgenes

Chaikof-Associated Protocol 2_Off-target editing AND Primers for sequencing analysis

Protocol  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium
This protocol describes in vivo adminstration and subsequent analysis of off-target editing in the liver.

AAVcc47_pTR_self comp 2xU6-Ai9 guides

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene

Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Chen Zheng-Yi  Last Updated Date: 2021-04-13
 
Delivery of Cas9/sgRNA mRNA via new LNPs to the cochlea by cochleostomy and gene editing is measured by percentage of tdTomato positive cells.

AAVcc47-Cre

Vector  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/5 expressing Cre recombinase

AAVrh8-ZsGreen-Cre

Vector  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

demo VV03-Cre

Vector  [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
DEMO viral vector for demo purpose

demo VV04-Cre

Vector  [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
DEMO viral vector for demo purpose

demo VV05-Cre

Vector  [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
DEMO viral vector for demo purpose

Pcsk9 Exon 1 splice domain

Guide  - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
Pcsk9 Exon 1 splice domain

AAV9-CMV-Cre

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV serotype 9 delivering CMV Cre Recombinase

[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Murray Stephen A  Last Updated Date: 2023-07-11
 
Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed.

CleanCap® Cas9 mRNA (5moU)

Genome Editor  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA.

RRID:AB_10711040 

Antibody  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Other Id: RRID:AB_10711040

RRID:AB_2937041 

Antibody  [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Other Id: GeneTex Product # GTX00837 RRID:AB_2937041
Chicken Polyclonal anti-NeuN antibody

AAV

Delivery System  - [In Vivo, In Vitro] [Delivery Systems, Biological Effects, AAV tropism] [Human, Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
See vector details

SaCas9

Genome Editor  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium

AAV+Focused Ultrasound

Delivery System  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium
See vector details

Ai14 mouse (congenic)

Model System  - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

RRID:AB_2762834 

Antibody 
Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium
Other Id: RRID:AB_2762834 ThermoFisher #A32794
Alexa fluor 555, Donkey anti-rabbit

RRID:AB_10563941 

Antibody  [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium
Other Id: Invitrogen, R10367 RRID:AB_10563941
Polyclonal rabbit anti-RFP antibody

gRNA #8

Guide  - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque]
Matched Fields: termSynonyms : Digestive tract epithelium Epithelium Endo-epithelium Unilaminar epithelium Foregut epithelium

AB_2532994 

Antibody  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: AB_2532994 13-0300 
Thermo-Fisher, Rat anti-GFAP

306-O12B blank

Delivery System  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Combinatorial library cationic lipid nanoparticles

L2-modified

Guide  - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
This gRNA targets the Ai9 and related transgenes

AAV-Pcsk9

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2021-09-16
 
A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

AAV9-Ai9-sgRNA1 + sgRNA2

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus

AAV9-Ai9-sgRNA2-CB-SaCas9

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus

AAVcc47-Ai9-sgRNA1-CB-SaCas9

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus

AAVcc47-CMV-SaCas9

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAVcc47 delivering CMV driven SaCas9

Chaikof-Associated Protocol 3_Serum ELISAs

Protocol  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
This protocol describes in vivo adminstration and subsequent blood draws and ELISA on C57BL/6J mice.

BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2

Vector  - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds

B6

Model System  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
C57BL/6J WT mouse

AAV Tropism project

Experiment  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Lutz Cathleen M , Gao Guang-Ping , Heaney Jason D , Murray Stephen A , Lagor William Raymond , Dickinson Mary E  Last Updated Date: 2023-02-10
 
Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging

AAV4-ZsGreen-Cre

Vector  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAVrh74-ZsGreen-Cre

Vector  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

STS204 (DNMT1; Sp_t2:Sp_c20_Dnmt1)

Guide  - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
For endogenous locus

RRID:AB_2313606 

Antibody  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Other Id: Vector Labs Cat# BA-1000 RRID:AB_2313606
Vector Labs Goat Anti-Rabbit IgG Biotinylated Cat. #BA-1000

RNP-NC-no ligand

Delivery System  - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA.

RNP-NC-RVG

Delivery System  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry

RRID:AB_2532994 

Antibody  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Other Id: RRID:AB_2532994

RRID:AB_2813835 

Antibody  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Other Id: RRID:AB_2813835

306-O12B

Delivery System  - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Combinatorial library cationic lipid nanoparticles

AAVcc84-GFP

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter

RRID:AB_10711040 

Antibody 
Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium
Other Id: Abcam, ab104224 RRID:AB_10711040
Mouse monoclonal [1B7] to NeuN - Neuronal Marker

SauCas9

Genome Editor  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium

FSD315

Delivery System  - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Rhesus macaque]
Matched Fields: termSynonyms : Digestive tract epithelium Epithelium Endo-epithelium Unilaminar epithelium Foregut epithelium
Shuttle peptide used to deliver reagents to airway epithelia
Show Experiments (7)

Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Sontheimer Erik J  Last Updated Date: 2021-10-01
 
Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain

Murray-SATC_Gong-Validation Brain Injection in Mice Protocol

Protocol  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Procedure for brain injection surgical procedure, pre- and post-operative care for mice.

AB_141637 

Antibody  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: AB_141637 A21207
Invitrogen, Donkey anti-rabbit alexa fluor 594

Testing gRNA sequence and gRNA scaffold modified in Ai9 mice.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Deverman Benjamin E  Last Updated Date: 2021-04-17
 
3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later.

CleanCap® Cas9

Genome Editor  - [In Vivo, In Vitro] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA.

AB_10015251 

Antibody  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: AB_10015251 25-6790
Anti-Myosin VIIa antibody, Proteus Biosciences

GFP-NLS

Genome Editor  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
Nuclear targeted GFP

150. Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia.

Publication  - [In Vivo, In Vitro] [Delivery Systems] [Human, Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
Krishnamurthy S, Wohlford-Lenane C, Kandimalla S, Sartre G, Meyerholz DK, Théberge V, Hallée S, Duperré AM, Del'Guidice T, Lepetit-Stoffaes JP, Barbeau X, Guay D, McCray PB
PII: 10.1038/s41467-019-12922-y, PUBMED 31659165, PMC PMC6817825, DOI 10.1038/s41467-019-12922-y

ABSTRACT: The delivery of biologic cargoes to airway epithelial cells is challenging due to the formidable barriers imposed by its specialized and differentiated cells. Among cargoes, recombinant proteins offer therapeutic promise but the lack of effective delivery methods limits their development. Here, we achieve protein and SpCas9 or AsCas12a ribonucleoprotein (RNP) delivery to cultured human well-differentiated airway epithelial cells and mouse lungs with engineered amphiphilic peptides. These shuttle ...
SCGE data tags...

H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP

Antibody  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Other Id:
Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200

RRID:AB_2717534 

Antibody  - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium
Other Id: RRID:AB_2717534 PA5-71680
rabbit polyclonal antibody against the pulmonary-associated surfactant protein C (SPC), unconjugated, PA5-71680, Invitrogen

Cre recombinase

Genome Editor  - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Epithelium of mucosa Ecto-epithelium Columnar epithelium Lung epithelium Epithelium
Cre recombinase delivered by AAV (see vector details)

Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway

Experiment  - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium
Liu David R , Guay David , McCray Paul B , Tarantal Alice F  Last Updated Date: 2023-03-15
 
We utilized novel amphiphilic shuttle peptides to deliver base editor ribonucleoprotein (RNP) into the airways to edit airway epithelial cells (CCR5 locus) of rhesus monkeys. The Cas9-ABE8e RNP and shuttle peptides S10 or FSD315 were aerosolized into the rhesus monkey trachea. Seven days later, tissues were obtained and dissected, and airway epithelia collected from the trachea, mainstem, and segmental bronchi using cytology brushes. DNA was extracted from epithelial cells and subjected to high-throughput sequencing. Using the FSD315 shuttle peptide and Cas9-ABE8e, we achieved a mean editing efficiency of 2.8% at the CCR5 locus in airway epithelial cells (range 0.02 – 5.3%) depending on the anatomic region sampled. To visualize the biodistribution of the RNPs within the respiratory tract and in specific cell types, we delivered a Cy5-fluorescent peptide fused to a nuclear localization signal (NLS-Cy5) using the S10 peptide. The lungs were obtained 1 and 2 hours post-delivery, fixed, and examined by microscopy. Epifluorescence and confocal microscopy documented an effective intra-nuclear delivery of NLS-Cy5 into epithelial cells throughout the respiratory tract, including large, medium, and small airways, and alveolar regions. Ongoing analyses will identify the NLS-Cy5-positive epithelial cell types using co-localization with fluorescently-labeled antibodies. In summary, using a rhesus monkey model, following a single delivery of adenine base editor RNPs to the airways in a clinically relevant manner we achieved up to 5.3% editing efficiency of the CCR5 locus in airway epithelia, a level considered therapeutically relevant in cystic fibrosis.

mTmG mouse (congenic)

Model System  - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Ecto-epithelium Meso-epithelium Lung epithelium Epithelium Endo-epithelium
mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed.
Show Experiments (7)

[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
Heaney Jason D  Last Updated Date: 2021-03-30
 
AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway

BCM_ssAAV5-Sp_sgB

Guide  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
This sgRNA targets the Ai9 and related transgenes

Ai9 mouse

Model System  - [In Vivo] [Delivery Systems, AAV tropism, Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchus termSynonyms : Ecto-epithelium Ciliated epithelium Meso-epithelium Epithelium Endo-epithelium
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.
Show Experiments (11)

On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium
Chaikof Elliot L.  Last Updated Date: 2022-04-15
 
On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10.

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2021-09-16
 
A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2021-09-16
 
A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

AAVcc47-Ai9-sgRNA1 + sgRNA2

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus

Pcsk9 adenine base editor efficiency in liver and nonliver tissue

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
Chaikof Elliot L.  Last Updated Date: 2022-04-15
 
Adenine base editing at the Pcsk9 exon 1 splice donor site in mouse heart, kidney, liver, lungs, muscle, and spleen was assessed one week after systemic administration of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs) in C56BL/6 mice

TadA-8e V106W

Genome Editor  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W)

AAV5-ZsGreen-Cre

Vector  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAV6-ZsGreen-Cre

Vector  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAV9-ZsGreen-Cre

Vector  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

demo VV01-Cre

Vector  [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
DEMO viral vector for demo purpose

STS159 (mTmG; Sp_t2:Sp_c20_mTmG)

Guide  - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
This sgRNA targets the mTmG transgene

RRID:AB_2536526 

Antibody  - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Other Id: Thermo Fisher Scientific Cat# G10362 RRID:AB_2536526
GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362

AAVcc47-CMV-Cre

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAVcc47 delivering CMV Cre Recombinase

RNP-NC-CPP

Delivery System  - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity

RRID:AB_141607 

Antibody  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Other Id: RRID:AB_141607

AAV9-mCherry

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter

AAVcc47-mCherry

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter

AAVcc81-GFP

Vector  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter

C57BL/6 mouse (Asokan study)

Model System  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium

179. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing.

Publication  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Gonzalez TJ, Simon KE, Blondel LO, Fanous MM, Roger AL, Maysonet MS, Devlin GW, Smith TJ, Oh DK, Havlik LP, Castellanos Rivera RM, Piedrahita JA, ElMallah MK, Gersbach CA, Asokan A
PII: 10.1038/s41467-022-33745-4, PUBMED 36210364, PMC PMC9548504, DOI 10.1038/s41467-022-33745-4

ABSTRACT: Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attrib ...
SCGE data tags...

RRID:AB_141607 

Antibody 
Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium
Other Id: RRID:AB_141607 Thermofisher #A21202
Alexa fluor 488, Donkey anti-mouse

AAVcc47-SaCas9-Ai9

Vector  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter

Ai9 SaCas9 Guide A

Guide  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium
This gRNA targets the Ai9 and related transgenes

Ai9 SaCas9 Guide B

Guide  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium
This gRNA targets the Ai9 and related transgenes

[Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Murray Stephen A  Last Updated Date: 2023-05-10
 
Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections.

Ai14 mouse

Model System  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Murray Stephen A  Last Updated Date: 2023-05-10
 
Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice

AB_10711040 

Antibody  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: AB_10711040 ab104224 
Abcam, mouse anti-NeuN

[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Murray Stephen A  Last Updated Date: 2023-05-10
 
Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice

[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Murray Stephen A  Last Updated Date: 2023-07-11
 
Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal.

[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Heaney Jason D  Last Updated Date: 2023-05-10
 
Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice

BI28:AAV-GFAP-SaCas9-WPRE3-pA

Vector  - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter

AB_2286684 

Antibody  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: AB_2286684 sc-17320
Sox-2 (Y-17) Antibody, Santa Cruz Biotechnology

193 results for Epithelium

Category Name Description Source View Associated...
Project Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Experiment Podocyte-specific gene editing in human kidney organoids Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter.
Experiment Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells.
Guide g-loxP2_C9 This sgRNA targets the Ai9 and related transgenes IDT
Guide sgAi9L This sgRNA targets the Ai9 and related transgenes IDT
Antibody Anti-RFP (Rabbit) Polyclonal Antibody
Model System BALB/c mouse BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). The Jackson Laboratory
Genome Editor SaCas9 Vector Encoded (ssaav5-sga+sgb-u1a.gfp)
Antibody GFP (D5.1) XP Rabbit mAb antibody
Antibody RRID:AB_310759  rabbit polyclonal antibody against club cell secretory protein, unconjugated, 07-623, EMD
Genome Editor Alt-R® S.p. Cas9 Nuclease V3 Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. Integrated DNA Technologies
Model System mTmG mouse ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence The Jackson Laboratory
Vector ssAAV5-sgB.saCas9 Gao Lab
Guide BCM_ssAAV5-Sa_sgB This gRNA targets the Ai9 and related transgenes Vector encoded
Experiment Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.
Antibody Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300
Delivery System S10 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Show Experiments (12)
Vector ssAAV5-sgA+sgB-U1A.GFP Gao Lab
Guide BCM_ssAAV5-Sp_sgA This sgRNA targets the Ai9 and related transgenes Vector encoded
Protocol Heaney-SATC_McCray-Validation_Intranasal Instillation in Mice Protocol Procedure for intranasal instillation of ribonucleoprotein/peptide complex in mice for delivery to the lung.
Antibody RRID:AB_2565050  rabbit polyclonal antibody to detect cytokeratin5+ basal cells, uncojugated, 905501, Biolegend
Delivery System D237 McCray Lab
Vector ssAAV5-spCas9 Gao Lab
Guide SpyCas9 g-loxP2_C9 This sgRNA targets the mTmG transgene IDT
Model System Ai9 mouse (BCM) Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Baylor College of Medicine
Protocol Heaney-SATC_McCray-Validation_Lung Inflation and Fixation Protocol Procedure for mouse lung inflation and fixation.
Genome Editor SpCas9 IDT
Protocol Heaney-SATC_Gao-Validation_Intratracheal Delivery of AAV in Mice Procedure for Intratracheal (IT) delivery of AAV in mouse lung.
Model System Ai9-SauSpyCas9 mouse Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Baylor College of Medicine
Antibody RRID:AB_2043201  anti-Wilms Tumor-1 (WT1)
Model System Macaca mulatta (Rhesus Macaque) Tarantal Lab
Guide sg298 This sgRNA targets the Ai9 and related transgenes at multiple sites Synthego
Experiment Testing AAV5 for activation of tdTomato in mouse airway AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation
Antibody Anti-RFP (RABBIT) Antibody
Experiment Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells.
Genome Editor AsCas12a (IDT and Feldan Therapeutics) IDT and Feldan Therapeutics
Guide g-loxPbot_C12a This sgRNA targets the Ai9 and related transgenes at two sites IDT
Vector scAAV5-Cre-GFP Gao Lab
Genome Editor SpCas9 HA-SV40NLS-SpCas9-SV40NLS Vector Encoded
Vector AAV.pU1a-SpCas9 Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS Addgene Gao Lab
Guide sgAi9R This sgRNA targets the Ai9 and related transgenes IDT
Antibody Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000
Antibody RRID:AB_477585  mouse monocolonal antibody against the acetylated α-tubulin, unconjugated, T6793, Sigma-Aldrich
Experiment [Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings
Delivery System D10 McCray Lab
Protocol Heaney_SATC Tissue Processing, Imaging and Analysis Procedure for tissue preparation, imaging and analysis.
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Vector AAV9_pTR_self comp 2xU6-Ai9 guides AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Asokan Lab
Vector AAVcc47-Ai9-sgRNA2-CB-SaCas9 AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Protocol Chaikof-Associated Protocol 1_Retro-orbital administration and High throughput sequencing This Protocol describes in vivo administration of BE-eVLP for Pcsk9 knockdown in liver, including sequencing endpoint.
Experiment [Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced.
Genome Editor ABE8e Catalytically impaired Cas fused to TadA deaminase Liu Lab
Delivery System eVLP engineered virus like particles Liu Lab
Vector AAV7-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAV8-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Genome Editor sNLS-SpCas9-sNLS SpCas9 with N- and C-terminal SV40 NLS Aldevron 9212-5MG
Guide sg298 This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases Synthego
Antibody RRID:AB_2762843  Goat anti-chicken IgG-Alexa Fluor 488
Delivery System 113-O12B combinatorial library cationic lipid nanoparticles Xu lab
Experiment Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.
Experiment Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.
Vector AAV9-GFP AAV2/9 self complementary vector expressing GFP driven by CBh promoter Asokan Lab
Delivery System 306-S10 combinatorial library cationic lipid nanoparticles Xu lab
Genome Editor ABE8e-Cas9 A-to-G base editor Feldan Therapeutics
Experiment Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Delivery of firefly luciferase mRNA via new Lipid NanoParticles by tail vein injection into WT C57BL/6J mice targeting the Liver and delivery is measured by luciferase expression.
Genome Editor CleanCap® Fluc Firefly luciferase mRNA capped using CleanCap. It is polyadenylated, modified with 5-methoxyuridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. Trilink Biotechnologies
Vector AAV9-Ai9-sgRNA1-CB-SaCas9 AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Vector AAV9-CMV-SaCas9 AAV serotype 9 delivering CMV driven SaCas9 Asokan Lab
Genome Editor ABE8e Tad8e deaminase fused to a nickase (D10A) spCas9 David Liu Lab
Publication Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. Methods to deliver gene editing agents in vivo as ribonucleoproteins could offer safety advantages over nucleic acid delivery approaches. We report the development and application of engineered DNA-free virus-like particles (eVLPs) that efficiently package and deliver base editor or Cas9 ribonucleoproteins. By engineering VLPs to overcome cargo packaging, release, and localization bottlenecks, we developed fourth-generation eVLPs that mediate efficient base editing in several primary mouse and human cell types. Using different glycoproteins in eVLPs alters their cellular tropism. Single injections of eVLPs into mice support therapeutic levels of base editing in multiple tissues, reducing serum Pcsk9 levels 78% following 63% liver editing, and partially restoring visual function in a mouse model of genetic blindness. In vitro and in vivo off-target editing from eVLPs was virtually undetected, an improvement over AAV or plasmid delivery. These results establish eVLPs as promising vehicles for therapeutic macromolecule delivery that combine key advantages of both viral and nonviral delivery.
Model System C57BL/6J mouse C57BL/6J WT mouse The Jackson Laboratory
Genome Editor SpyCas9-3xNLS SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal Sontheimer lab
Vector AAV3b-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAVrh10-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector demo VV02-Cre DEMO viral vector for demo purpose Virus Company X
Experiment Cre Recombinase dose escalation study in Ai9 mice A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images.
Experiment [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed.
Guide Ai14 gRNA This sgRNA targets the Ai9 and related transgenes at multiple sites IDT
Antibody RRID:AB_2633281  Goat anti-rabbit IgG-Alexa Fluor 555
Antibody RRID:AB_2209751 
Antibody RRID:AB_141637 
Experiment [Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.
Experiment Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression.
Protocol Murray-SATC_Gong-Validaiton_Gong Study Protocol Procedure for intracranial injection, immunofluorescence and imaging.
Antibody AB_2209751  Anti-RFP (RABBIT) Antibody
Experiment [Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice
Protocol Gong_Intracranial Injection Procedure for Mice Procedure for intracranial delivery to mouse brain.
Antibody AB_2813835  Abcam, Donkey anti-rat alexa fluour 647
Antibody AB_141607  Invitrogen, Donkey anti-mouse alexafluor 488
Guide R2-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Protocol Deverman_Comprehensive Methods Procedure for plasmid cloning, editing evaluation in fibroblast, AAV production and administration, tissue processing and IHC.
Protocol Deverman_Area Based Quantification of Editing Efficiency Protocol Procedure for non-IHC based image quantification of editing.
Guide L1-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Protocol Chaikof-Associated Protocol 2_Off-target editing AND Primers for sequencing analysis This protocol describes in vivo adminstration and subsequent analysis of off-target editing in the liver.
Vector AAVcc47_pTR_self comp 2xU6-Ai9 guides AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Asokan Lab
Experiment Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Delivery of Cas9/sgRNA mRNA via new LNPs to the cochlea by cochleostomy and gene editing is measured by percentage of tdTomato positive cells.
Vector AAVcc47-Cre AAV2/5 expressing Cre recombinase Asokan Lab
Vector AAVrh8-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector demo VV03-Cre DEMO viral vector for demo purpose Virus Company X
Vector demo VV04-Cre DEMO viral vector for demo purpose Virus Company X
Vector demo VV05-Cre DEMO viral vector for demo purpose Virus Company X
Guide Pcsk9 Exon 1 splice domain Pcsk9 Exon 1 splice domain Synthego
Vector AAV9-CMV-Cre AAV serotype 9 delivering CMV Cre Recombinase Asokan Lab
Experiment [Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed.
Genome Editor CleanCap® Cas9 mRNA (5moU) SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. Trilink Biotechnologies
Antibody RRID:AB_10711040 
Antibody RRID:AB_2937041  Chicken Polyclonal anti-NeuN antibody
Delivery System AAV See vector details
Genome Editor SaCas9 Leong Lab
Delivery System AAV+Focused Ultrasound See vector details Leong Lab
Model System Ai14 mouse (congenic) Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory
Antibody RRID:AB_2762834  Alexa fluor 555, Donkey anti-rabbit
Antibody RRID:AB_10563941  Polyclonal rabbit anti-RFP antibody
Guide gRNA #8 IDT
Antibody AB_2532994  Thermo-Fisher, Rat anti-GFAP
Delivery System 306-O12B blank Combinatorial library cationic lipid nanoparticles Xu lab
Guide L2-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Vector AAV-Pcsk9
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Genome Editor SaCas9-Lagor William Lagor, Baylor College Of Medicine
Vector AAV9-Ai9-sgRNA1 + sgRNA2 AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Asokan Lab
Vector AAV9-Ai9-sgRNA2-CB-SaCas9 AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Vector AAVcc47-Ai9-sgRNA1-CB-SaCas9 AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Vector AAVcc47-CMV-SaCas9 AAVcc47 delivering CMV driven SaCas9 Asokan Lab
Protocol Chaikof-Associated Protocol 3_Serum ELISAs This protocol describes in vivo adminstration and subsequent blood draws and ELISA on C57BL/6J mice.
Vector BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2 Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds Deverman Lab
Model System B6 C57BL/6J WT mouse Baylor College of Medicine
Experiment AAV Tropism project Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging
Vector AAV4-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAVrh74-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Guide STS204 (DNMT1; Sp_t2:Sp_c20_Dnmt1) For endogenous locus in house production
Antibody RRID:AB_2313606  Vector Labs Goat Anti-Rabbit IgG Biotinylated Cat. #BA-1000
Delivery System RNP-NC-no ligand The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. Gong Lab
Delivery System RNP-NC-RVG The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry Gong Lab
Antibody RRID:AB_2532994 
Antibody RRID:AB_2813835 
Delivery System 306-O12B Combinatorial library cationic lipid nanoparticles Xu lab
Vector AAVcc84-GFP AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter Asokan Lab
Antibody RRID:AB_10711040  Mouse monoclonal [1B7] to NeuN - Neuronal Marker
Genome Editor SauCas9
Delivery System FSD315 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Show Experiments (7)
Experiment Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain
Antibody RRID:AB_1196615  GFP (D5.1) XP Rabbit mAb antibody, Cell Signaling Technology
Protocol Murray-SATC_Gong-Validation Brain Injection in Mice Protocol Procedure for brain injection surgical procedure, pre- and post-operative care for mice.
Antibody AB_141637  Invitrogen, Donkey anti-rabbit alexa fluor 594
Experiment Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later.
Genome Editor CleanCap® Cas9 SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. Trilink Biotechnologies
Antibody AB_10015251  Anti-Myosin VIIa antibody, Proteus Biosciences
Genome Editor GFP-NLS Nuclear targeted GFP Expressed From (Escherichia coli BL21DE3)
Publication Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia. The delivery of biologic cargoes to airway epithelial cells is challenging due to the formidable barriers imposed by its specialized and differentiated cells. Among cargoes, recombinant proteins offer therapeutic promise but the lack of effective delivery methods limits their development. Here, we achieve protein and SpCas9 or AsCas12a ribonucleoprotein (RNP) delivery to cultured human well-differentiated airway epithelial cells and mouse lungs with engineered amphiphilic peptides. These shuttle peptides, non-covalently combined with GFP protein or CRISPR-associated nuclease (Cas) RNP, allow rapid entry into cultured human ciliated and non-ciliated epithelial cells and mouse airway epithelia. Instillation of shuttle peptides combined with SpCas9 or AsCas12a RNP achieves editing of loxP sites in airway epithelia of ROSAmT/mG mice. We observe no evidence of short-term toxicity with a widespread distribution restricted to the respiratory tract. This peptide-based technology advances potential therapeutic avenues for protein and Cas RNP delivery to refractory airway epithelial cells.
Vector H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP Addgene Gao Lab
Antibody Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200
Antibody RRID:AB_2717534  rabbit polyclonal antibody against the pulmonary-associated surfactant protein C (SPC), unconjugated, PA5-71680, Invitrogen
Genome Editor Cre recombinase Cre recombinase delivered by AAV (see vector details)
Experiment Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway We utilized novel amphiphilic shuttle peptides to deliver base editor ribonucleoprotein (RNP) into the airways to edit airway epithelial cells (CCR5 locus) of rhesus monkeys. The Cas9-ABE8e RNP and shuttle peptides S10 or FSD315 were aerosolized into the rhesus monkey trachea. Seven days later, tissues were obtained and dissected, and airway epithelia collected from the trachea, mainstem, and segmental bronchi using cytology brushes. DNA was extracted from epithelial cells and subjected to high-throughput sequencing. Using the FSD315 shuttle peptide and Cas9-ABE8e, we achieved a mean editing efficiency of 2.8% at the CCR5 locus in airway epithelial cells (range 0.02 – 5.3%) depending on the anatomic region sampled. To visualize the biodistribution of the RNPs within the respiratory tract and in specific cell types, we delivered a Cy5-fluorescent peptide fused to a nuclear localization signal (NLS-Cy5) using the S10 peptide. The lungs were obtained 1 and 2 hours post-delivery, fixed, and examined by microscopy. Epifluorescence and confocal microscopy documented an effective intra-nuclear delivery of NLS-Cy5 into epithelial cells throughout the respiratory tract, including large, medium, and small airways, and alveolar regions. Ongoing analyses will identify the NLS-Cy5-positive epithelial cell types using co-localization with fluorescently-labeled antibodies. In summary, using a rhesus monkey model, following a single delivery of adenine base editor RNPs to the airways in a clinically relevant manner we achieved up to 5.3% editing efficiency of the CCR5 locus in airway epithelia, a level considered therapeutically relevant in cystic fibrosis.
Model System mTmG mouse (congenic) mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. The Jackson Laboratory
Show Experiments (7)
Experiment [Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway
Guide BCM_ssAAV5-Sp_sgB This sgRNA targets the Ai9 and related transgenes Vector encoded
Model System Ai9 mouse Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The Jackson Laboratory
Show Experiments (11)
Experiment On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10.
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Experiment Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Vector AAVcc47-Ai9-sgRNA1 + sgRNA2 AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Asokan Lab
Experiment Pcsk9 adenine base editor efficiency in liver and nonliver tissue Adenine base editing at the Pcsk9 exon 1 splice donor site in mouse heart, kidney, liver, lungs, muscle, and spleen was assessed one week after systemic administration of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs) in C56BL/6 mice
Genome Editor TadA-8e V106W Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W) Chaikof Lab
Vector AAV5-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAV6-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAV9-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector demo VV01-Cre DEMO viral vector for demo purpose Virus Company X
Guide STS159 (mTmG; Sp_t2:Sp_c20_mTmG) This sgRNA targets the mTmG transgene in house production
Antibody RRID:AB_2536526  GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362
Vector AAVcc47-CMV-Cre AAVcc47 delivering CMV Cre Recombinase Asokan Lab
Delivery System RNP-NC-CPP The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity Gong Lab
Antibody RRID:AB_141607 
Vector AAV9-mCherry AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter Asokan Lab
Vector AAVcc47-mCherry AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter Asokan Lab
Vector AAVcc81-GFP AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter Asokan Lab
Model System C57BL/6 mouse (Asokan study) Unspecified
Publication Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing. Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attributes benchmarked against AAV serotype 9 as evidenced by robust reporter and therapeutic gene expression, Cre recombination and CRISPR genome editing in normal and diseased mouse models. Enhanced transduction efficiency of AAV.cc47 vectors is further corroborated in macaques and pigs, providing a strong rationale for potential clinical translation into human gene therapies. We envision that ccAAV vectors may not only improve predictive modeling in preclinical studies, but also clinical translatability by broadening the therapeutic window of AAV based gene therapies.
Antibody RRID:AB_141607  Alexa fluor 488, Donkey anti-mouse
Vector AAVcc47-SaCas9-Ai9 AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter Asokan Lab
Guide Ai9 SaCas9 Guide A This gRNA targets the Ai9 and related transgenes Vector encoded
Guide Ai9 SaCas9 Guide B This gRNA targets the Ai9 and related transgenes Vector encoded
Experiment [Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections.
Model System Ai14 mouse Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory
Experiment [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice
Antibody AB_10711040  Abcam, mouse anti-NeuN
Experiment [Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice
Experiment [Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal.
Experiment [Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice
Genome Editor SaCas9
Vector BI28:AAV-GFAP-SaCas9-WPRE3-pA Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter Deverman Lab
Antibody AB_2286684  Sox-2 (Y-17) Antibody, Santa Cruz Biotechnology