Search Result for Epithelium

Table View
List View

197 results for Epithelium

Cas9 ribonucleoprotein delivery targeted to kidney epithelium Project [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] Matched Fields: name : Cas9 ribonucleoprotein delivery targeted to kidney epithelium Wilson Ross C. , Freedman Benjamin S Last Updated Date: 2024-01-16 Show Experiments (1) Podocyte-specific gene editing in human kidney organoids
Podocyte-specific gene editing in human kidney organoids Experiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium Wilson Ross C. , Freedman Benjamin S Last Updated Date: 2024-01-16 Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter. Show Project Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: description : Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium McCray Paul B Last Updated Date: 2020-11-02 Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells. Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
sg298 Guide - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] [Mouse] Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium termSynonyms : Ecto-epithelium Epithelium This sgRNA targets the Ai9 and related transgenes at multiple sites Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Podocyte-specific gene editing in human kidney organoids
GFP-NLS Genome Editor - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Nuclear targeted GFP Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
g-loxP2_C9 Guide - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium This sgRNA targets the Ai9 and related transgenes Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
sgAi9L Guide - [In Vivo, In Vitro] [Delivery Systems] [Human, Mouse] Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium This sgRNA targets the Ai9 and related transgenes Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
ssAAV5-sgB.saCas9 Vector - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Lung epithelium Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium McCray Paul B Last Updated Date: 2020-11-02 In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells. Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Other Id: Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000 Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Other Id: Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200 Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Testing AAV5 for activation of tdTomato in mouse airway Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Gao Guang-Ping Last Updated Date: 2020-10-20 AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
SpCas9 Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Biological Effects] [Human, Mouse] Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium HA-SV40NLS-SpCas9-SV40NLS Show Experiments (4) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway A novel human T cell platform to define biological adverse effects of genome editing Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
AAV.pU1a-SpCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
g-loxPbot_C12a Guide - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium This sgRNA targets the Ai9 and related transgenes at two sites Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
BALB/c mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
mTmG mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Cre recombinase Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Epithelium of mucosa Ecto-epithelium Columnar epithelium Lung epithelium Epithelium Cre recombinase delivered by AAV (see vector details) Show Experiments (4) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Cre Recombinase dose escalation study in Ai9 mice Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
SaCas9 Genome Editor - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Lung epithelium Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Other Id: Anti-RFP (RABBIT) Antibody Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
S10 Delivery System - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Mouse, Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Lung epithelium Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (12) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Gao Guang-Ping Last Updated Date: 2021-09-21 AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types. Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Other Id: Anti-RFP (Rabbit) Polyclonal Antibody Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
RRID:AB_2717534 Antibody - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Other Id: RRID:AB_2717534 PA5-71680 rabbit polyclonal antibody against the pulmonary-associated surfactant protein C (SPC), unconjugated, PA5-71680, Invitrogen Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Ai9 mouse (BCM) Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Heaney-SATC_Gao-Validation_Intratracheal Delivery of AAV in Mice Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Procedure for Intratracheal (IT) delivery of AAV in mouse lung. Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Heaney_SATC Tissue Processing, Imaging and Analysis Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Ecto-epithelium Meso-epithelium Lung epithelium Epithelium Endo-epithelium Procedure for tissue preparation, imaging and analysis. Show Experiments (4) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
D237 Delivery System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
SpyCas9 g-loxP2_C9 Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium This sgRNA targets the mTmG transgene Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Alt-R® S.p. Cas9 Nuclease V3 Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Ecto-epithelium Columnar epithelium Lung epithelium Epithelium Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. Show Experiments (10) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Validating Gene Editing Reporter 12 (GER12) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for NHEJ in Heterozygous Blastocysts Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 18 (GER18) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 19 (GER19) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for HDR in Heterozygous Blastocysts Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Homozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
ssAAV5-spCas9 Vector - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
BCM_ssAAV5-Sp_sgA Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium This sgRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Heaney-SATC_McCray-Validation_Intranasal Instillation in Mice Protocol Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Procedure for intranasal instillation of ribonucleoprotein/peptide complex in mice for delivery to the lung. Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
D10 Delivery System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
ssAAV5-sgA+sgB-U1A.GFP Vector - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Heaney Jason D Last Updated Date: 2021-03-30 AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Gao Validation (Gao, Guang-Ping )
RRID:AB_2043201 Antibody - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium Other Id: RRID:AB_2043201 Abcam (ab89901) anti-Wilms Tumor-1 (WT1) Show Experiments (1) Podocyte-specific gene editing in human kidney organoids
mTmG mouse (congenic) Model System - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Ecto-epithelium Meso-epithelium Lung epithelium Epithelium Endo-epithelium mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. Show Experiments (7) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Ai9 mouse Model System - [In Vivo] [Delivery Systems, AAV tropism, Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchus termSynonyms : Ecto-epithelium Ciliated epithelium Meso-epithelium Epithelium Endo-epithelium Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Ai9-SauSpyCas9 mouse Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway Experiment - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Liu David R , Guay David , McCray Paul B , Tarantal Alice F Last Updated Date: 2023-03-15 We utilized novel amphiphilic shuttle peptides to deliver base editor ribonucleoprotein (RNP) into the airways to edit airway epithelial cells (CCR5 locus) of rhesus monkeys. The Cas9-ABE8e RNP and shuttle peptides S10 or FSD315 were aerosolized into the rhesus monkey trachea. Seven days later, tissues were obtained and dissected, and airway epithelia collected from the trachea, mainstem, and segmental bronchi using cytology brushes. DNA was extracted from epithelial cells and subjected to high-throughput sequencing. Using the FSD315 shuttle peptide and Cas9-ABE8e, we achieved a mean editing efficiency of 2.8% at the CCR5 locus in airway epithelial cells (range 0.02 – 5.3%) depending on the anatomic region sampled. To visualize the biodistribution of the RNPs within the respiratory tract and in specific cell types, we delivered a Cy5-fluorescent peptide fused to a nuclear localization signal (NLS-Cy5) using the S10 peptide. The lungs were obtained 1 and 2 hours post-delivery, fixed, and examined by microscopy. Epifluorescence and confocal microscopy documented an effective intra-nuclear delivery of NLS-Cy5 into epithelial cells throughout the respiratory tract, including large, medium, and small airways, and alveolar regions. Ongoing analyses will identify the NLS-Cy5-positive epithelial cell types using co-localization with fluorescently-labeled antibodies. In summary, using a rhesus monkey model, following a single delivery of adenine base editor RNPs to the airways in a clinically relevant manner we achieved up to 5.3% editing efficiency of the CCR5 locus in airway epithelia, a level considered therapeutically relevant in cystic fibrosis. Show Project Base Editing in Rhesus Airway Epithelial
Macaca mulatta (Rhesus Macaque) Model System - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Other Id: GFP (D5.1) XP Rabbit mAb antibody Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
AsCas12a (IDT and Feldan Therapeutics) Genome Editor - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
46. Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia. Publication - [In Vivo, In Vitro] [Delivery Systems] [Human, Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Krishnamurthy S, Wohlford-Lenane C, Kandimalla S, Sartre G, Meyerholz DK, Théberge V, Hallée S, Duperré AM, Del'Guidice T, Lepetit-Stoffaes JP, Barbeau X, Guay D, McCray PB PII: 10.1038/s41467-019-12922-y, PUBMED 31659165, PMC PMC6817825, DOI 10.1038/s41467-019-12922-y ABSTRACT: The delivery of biologic cargoes to airway epithelial cells is challenging due to the formidable barriers imposed by its specialized and differentiated cells. Among cargoes, recombinant proteins offer therapeutic promise but the lack of effective delivery methods limits their development. Here, we achieve protein and SpCas9 or AsCas12a ribonucleoprotein (RNP) delivery to cultured human well-differentiated airway epithelial cells and mouse lungs with engineered amphiphilic peptides. These shuttle ... SCGE data tags... Delivery System S10; Projects Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
scAAV5-Cre-GFP Vector - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Lung epithelium Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
BCM_ssAAV5-Sa_sgB Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Lung epithelium This gRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
sgAi9R Guide - [In Vivo, In Vitro] [Delivery Systems] [Human, Mouse] Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium This sgRNA targets the Ai9 and related transgenes Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium Other Id: Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300 Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
RRID:AB_477585 Antibody - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Other Id: RRID:AB_477585 T6793 mouse monocolonal antibody against the acetylated α-tubulin, unconjugated, T6793, Sigma-Aldrich Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
RRID:AB_310759 Antibody - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Other Id: RRID:AB_310759 07-623 rabbit polyclonal antibody against club cell secretory protein, unconjugated, 07-623, EMD Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
RRID:AB_2565050 Antibody - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque] Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium Other Id: 905501.0 RRID:AB_2565050 rabbit polyclonal antibody to detect cytokeratin5+ basal cells, uncojugated, 905501, Biolegend Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Heaney Jason D Last Updated Date: 2021-09-07 Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - McCray Validation (McCray Jr., Paul)
SpCas9 Genome Editor - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Show Experiments (2) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Heaney-SATC_McCray-Validation_Lung Inflation and Fixation Protocol Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium Procedure for mouse lung inflation and fixation. Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
BCM_ssAAV5-Sp_sgB Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium This sgRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
AAV9-Ai9-sgRNA1-CB-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAVcc47-Ai9-sgRNA1 + sgRNA2 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
CleanCap® Fluc Genome Editor - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium Firefly luciferase mRNA capped using CleanCap. It is polyadenylated, modified with 5-methoxyuridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. Show Experiments (1) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
AAV9_pTR_self comp 2xU6-Ai9 guides Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
AAVcc47-Ai9-sgRNA1-CB-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAVcc47_pTR_self comp 2xU6-Ai9 guides Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium Chen Zheng-Yi Last Updated Date: 2021-04-13 Delivery of firefly luciferase mRNA via new Lipid NanoParticles by tail vein injection into WT C57BL/6J mice targeting the Liver and delivery is measured by luciferase expression. Show Project Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles
Chaikof-Associated Protocol 2_Off-target editing AND Primers for sequencing analysis Protocol - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium This protocol describes in vivo adminstration and subsequent analysis of off-target editing in the liver. Show Experiments (1) On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Pcsk9 adenine base editor efficiency in liver and nonliver tissue Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium Chaikof Elliot L. Last Updated Date: 2022-04-15 Adenine base editing at the Pcsk9 exon 1 splice donor site in mouse heart, kidney, liver, lungs, muscle, and spleen was assessed one week after systemic administration of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs) in C56BL/6 mice Show Project Delivery Technologies for In Vivo Genome Editing
TadA-8e V106W Genome Editor - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W) Show Experiments (2) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Chaikof-Associated Protocol 1_Retro-orbital administration and High throughput sequencing Protocol - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium This Protocol describes in vivo administration of BE-eVLP for Pcsk9 knockdown in liver, including sequencing endpoint. Show Experiments (1) Pcsk9 adenine base editor efficiency in liver and nonliver tissue
Chaikof-Associated Protocol 3_Serum ELISAs Protocol - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium This protocol describes in vivo adminstration and subsequent blood draws and ELISA on C57BL/6J mice. Show Experiments (1) Pcsk9 adenine base editor efficiency in liver and nonliver tissue
71. Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. Publication - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium Banskota S, Raguram A, Suh S, Du SW, Davis JR, Choi EH, Wang X, Nielsen SC, Newby GA, Randolph PB, Osborn MJ, Musunuru K, Palczewski K, Liu DR PII: S0092-8674(21)01484-7, PUBMED 35021064, PMC PMC8809250, DOI 10.1016/j.cell.2021.12.021 ABSTRACT: Methods to deliver gene editing agents in vivo as ribonucleoproteins could offer safety advantages over nucleic acid delivery approaches. We report the development and application of engineered DNA-free virus-like particles (eVLPs) that efficiently package and deliver base editor or Cas9 ribonucleoproteins. By engineering VLPs to overcome cargo packaging, release, and localization bottlenecks, we developed fourth-generation eVLPs that mediate efficient base editing in several primary mouse and h ... SCGE data tags... Projects Delivery Technologies for In Vivo Genome Editing
SaCas9-Lagor Genome Editor - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (4) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
AAV9-CMV-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering CMV driven SaCas9 Show Experiments (3) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
AAVcc47-Ai9-sgRNA2-CB-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAVcc47-CMV-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAVcc47 delivering CMV driven SaCas9 Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
ABE8e Genome Editor - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Mouse, Rhesus macaque] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium Tad8e deaminase fused to a nickase (D10A) spCas9 Show Experiments (1) Rhesus macaque CCR5 gRNA screening using ABE8e-Cas9
AAV4-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
STS159 (mTmG; Sp_t2:Sp_c20_mTmG) Guide - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium This sgRNA targets the mTmG transgene Show Experiments (4) Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
AAVcc47-CMV-Cre Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAVcc47 delivering CMV Cre Recombinase Show Experiments (1) Cre Recombinase dose escalation study in Ai9 mice
eVLP Delivery System - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium engineered virus like particles Show Experiments (3) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
AAV7-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
demo VV01-Cre Vector [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium DEMO viral vector for demo purpose
demo VV05-Cre Vector [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium DEMO viral vector for demo purpose
AAV9-CMV-Cre Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering CMV Cre Recombinase Show Experiments (1) Cre Recombinase dose escalation study in Ai9 mice
AAVcc47-Cre Vector - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/5 expressing Cre recombinase Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
RRID:AB_2633281 Antibody [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Other Id: RRID:AB_2633281 Invitrogen Product #A32732 Goat anti-rabbit IgG-Alexa Fluor 555
RRID:AB_141637 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Other Id: RRID:AB_141637 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_2937041 Antibody [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Other Id: GeneTex Product # GTX00837 RRID:AB_2937041 Chicken Polyclonal anti-NeuN antibody
Pcsk9 Exon 1 splice domain Guide - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium Pcsk9 Exon 1 splice domain Show Experiments (2) Pcsk9 adenine base editor efficiency in liver and nonliver tissue Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
B6 Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium C57BL/6J WT mouse Show Experiments (1) Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
C57BL/6J mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium C57BL/6J WT mouse Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Murray Stephen A Last Updated Date: 2023-07-18 Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed. Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Gong, Submission 2 (On- and Off-target data)
RNP-NC-CPP Delivery System - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
RRID:AB_10711040 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Other Id: RRID:AB_10711040 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
AAV Tropism project Experiment - [In Vivo] [AAV tropism] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Lutz Cathleen M , Gao Guang-Ping , Heaney Jason D , Murray Stephen A , Lagor William Raymond , Dickinson Mary E Last Updated Date: 2023-02-10 Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging Show Project SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice
Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Murray Stephen A Last Updated Date: 2024-08-30 Heterozygous embryos containing the traffic light reporter 2 (TLR-2) reporter at the Rosa26 locus were evaluated for activation potential following electroporation of two guide/RNP combinations and transfer to pseudo-pregnant hosts for development to term. Offspring (founders) with activating edits were mated to wild-type females and adult tissues from progeny were assessed for tagRFP fluorescence. Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - TLR2 small animal reporter, submission 2 (Tier 1 & 2 validation)
SpyCas9-3xNLS Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Human, Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal Show Experiments (7) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
AAV3b-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAV5-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAV6-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAVrh74-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
demo VV03-Cre Vector [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium DEMO viral vector for demo purpose
R26-2 Guide - [In Vivo, In Vitro] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (3) Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Homozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
R26-52 Guide - [In Vivo, In Vitro] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (2) Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
STS204 (DNMT1; Sp_t2:Sp_c20_Dnmt1) Guide - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium For endogenous locus Show Experiments (2) Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
306-O12B Delivery System - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Combinatorial library cationic lipid nanoparticles Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium Chaikof Elliot L. Last Updated Date: 2022-04-15 On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10. Show Project Delivery Technologies for In Vivo Genome Editing
AAV-Pcsk9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium Show Experiments (1) On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2020-11-19 C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
AAV9-GFP Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/9 self complementary vector expressing GFP driven by CBh promoter Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
AAV9-mCherry Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter Show Experiments (1) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
CleanCap® Cas9 mRNA (5moU) Genome Editor - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
RNP-NC-no ligand Delivery System - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. Show Experiments (4) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
RNP-NC-RVG Delivery System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry Show Experiments (2) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Ai14 gRNA Guide - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium This sgRNA targets the Ai9 and related transgenes at multiple sites Show Experiments (3) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_2209751 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Other Id: RRID:AB_2209751 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
C57BL/6 mouse (Asokan study) Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (2) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
RRID:AB_141607 Antibody [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium Other Id: RRID:AB_141607 Thermofisher #A21202 Alexa fluor 488, Donkey anti-mouse
306-S10 Delivery System - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium combinatorial library cationic lipid nanoparticles Show Experiments (5) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
AAVcc47-SaCas9-Ai9 Vector - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium Heaney Jason D Last Updated Date: 2021-03-30 Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues. Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Asokan Validation (Asokan, Aravind)
SauCas9 Genome Editor - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Ai9 SaCas9 Guide A Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium This gRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
113-O12B Delivery System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium combinatorial library cationic lipid nanoparticles Show Experiments (2) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
AAVcc84-GFP Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2020-11-19 C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
AAVcc47-mCherry Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter Show Experiments (1) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
AAVcc81-GFP Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
AAV9-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
RRID:AB_10563941 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium Other Id: Invitrogen, R10367 RRID:AB_10563941 Polyclonal rabbit anti-RFP antibody Show Experiments (1) Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium Heaney Jason D Last Updated Date: 2023-12-18 Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced. Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Chaikof Validation (Chaikof, Elliot L. )
ABE8e Genome Editor - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium Catalytically impaired Cas fused to TadA deaminase Show Experiments (1) Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Cre Recombinase dose escalation study in Ai9 mice Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2021-09-16 A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
TLR-2 mouse Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways. Show Experiments (1) Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
FSD315 Delivery System - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Rhesus macaque] Matched Fields: termSynonyms : Digestive tract epithelium Epithelium Endo-epithelium Unilaminar epithelium Foregut epithelium Shuttle peptide used to deliver reagents to airway epithelia Show Experiments (7) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Murray Stephen A Last Updated Date: 2023-07-11 Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed. Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data)
sNLS-SpCas9-sNLS Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium SpCas9 with N- and C-terminal SV40 NLS Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
RRID:AB_2762843 Antibody [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Other Id: Invitrogen Product # A32931 RRID:AB_2762843 Goat anti-chicken IgG-Alexa Fluor 488
RRID:AB_2813835 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Other Id: RRID:AB_2813835 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
RRID:AB_141607 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Other Id: RRID:AB_141607 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
gRNA #8 Guide - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque] Matched Fields: termSynonyms : Digestive tract epithelium Epithelium Endo-epithelium Unilaminar epithelium Foregut epithelium Show Experiments (2) Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
SaCas9 Genome Editor - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
AAV+Focused Ultrasound Delivery System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium See vector details Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
RRID:AB_10711040 Antibody [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium Other Id: Abcam, ab104224 RRID:AB_10711040 Mouse monoclonal [1B7] to NeuN - Neuronal Marker
RRID:AB_2762834 Antibody [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium Other Id: RRID:AB_2762834 ThermoFisher #A32794 Alexa fluor 555, Donkey anti-rabbit
[Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Murray Stephen A Last Updated Date: 2023-05-10 Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections. Show Project The Jackson Laboratory Gene Editing Testing Center - Sontheimer Validation (Sontheimer, Eric)
Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Gong Shaoqin (Sarah) Last Updated Date: 2020-10-28 Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression. Show Project Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
Gong_Intracranial Injection Procedure for Mice Protocol - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Procedure for intracranial delivery to mouse brain. Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Murray Stephen A Last Updated Date: 2023-05-10 Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice Show Project The Jackson Laboratory Gene Editing Testing Center - Gong Validation (Gong, Shaoqin)
Murray-SATC_Gong-Validation Brain Injection in Mice Protocol Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Procedure for brain injection surgical procedure, pre- and post-operative care for mice. Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Murray-SATC_Gong-Validaiton_Gong Study Protocol Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Procedure for intracranial injection, immunofluorescence and imaging. Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
AB_141637 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: AB_141637 A21207 Invitrogen, Donkey anti-rabbit alexa fluor 594 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
AB_2813835 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: ab150155 AB_2813835 Abcam, Donkey anti-rat alexa fluour 647 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Ai14 mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Murray Stephen A Last Updated Date: 2023-05-10 Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice Show Project The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi)
AB_10711040 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: AB_10711040 ab104224 Abcam, mouse anti-NeuN Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Murray Stephen A Last Updated Date: 2023-05-10 Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice Show Project The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi)
306-O12B blank Delivery System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Combinatorial library cationic lipid nanoparticles Show Experiments (2) Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Murray Stephen A Last Updated Date: 2023-07-11 Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal. Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data)
Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Deverman Benjamin E Last Updated Date: 2021-04-17 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later. Show Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System
L2-modified Guide - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium This gRNA targets the Ai9 and related transgenes Show Experiments (2) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Heaney Jason D Last Updated Date: 2023-05-10 Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Deverman Validation (Deverman, Benjamin)
SaCas9 Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2 Vector - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
BI28:AAV-GFAP-SaCas9-WPRE3-pA Vector - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Deverman_Area Based Quantification of Editing Efficiency Protocol Protocol - [In Vivo, In Vitro] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Procedure for non-IHC based image quantification of editing. Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Chen Zheng-Yi Last Updated Date: 2021-04-13 Delivery of Cas9/sgRNA mRNA via new LNPs to the cochlea by cochleostomy and gene editing is measured by percentage of tdTomato positive cells. Show Project Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles
AB_2286684 Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: AB_2286684 sc-17320 Sox-2 (Y-17) Antibody, Santa Cruz Biotechnology Show Experiments (1) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
CleanCap® Cas9 Genome Editor - [In Vivo, In Vitro] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. Show Experiments (2) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
AB_10015251 Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: AB_10015251 25-6790 Anti-Myosin VIIa antibody, Proteus Biosciences Show Experiments (1) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
AAV9-Ai9-sgRNA1 + sgRNA2 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
AAV9-Ai9-sgRNA2-CB-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAV8-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAVrh10-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAVrh8-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
demo VV02-Cre Vector [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium DEMO viral vector for demo purpose
demo VV04-Cre Vector [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium DEMO viral vector for demo purpose
RRID:AB_2536526 Antibody - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Other Id: Thermo Fisher Scientific Cat# G10362 RRID:AB_2536526 GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362 Show Experiments (3) Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
RRID:AB_2313606 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Other Id: Vector Labs Cat# BA-1000 RRID:AB_2313606 Vector Labs Goat Anti-Rabbit IgG Biotinylated Cat. #BA-1000 Show Experiments (1) Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
sg298 Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
RRID:AB_2532994 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Other Id: RRID:AB_2532994 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
AAV Delivery System - [In Vivo, In Vitro] [Delivery Systems, Biological Effects, AAV tropism] [Human, Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium See vector details Show Experiments (9) Cre Recombinase dose escalation study in Ai9 mice AAV Tropism project AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids. Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
186. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing. Publication - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Gonzalez TJ, Simon KE, Blondel LO, Fanous MM, Roger AL, Maysonet MS, Devlin GW, Smith TJ, Oh DK, Havlik LP, Castellanos Rivera RM, Piedrahita JA, ElMallah MK, Gersbach CA, Asokan A PII: 10.1038/s41467-022-33745-4, PUBMED 36210364, PMC PMC9548504, DOI 10.1038/s41467-022-33745-4 ABSTRACT: Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attrib ... SCGE data tags... Organisms: Mouse; Models: Ai9 mouse; Editors SaCas9-Lagor; Vectors AAV9-CMV-Cre; AAVcc47-CMV-Cre; AAV9-Ai9-sgRNA2-CB-SaCas9; AAVcc47-Ai9-sgRNA1-CB-SaCas9; AAVcc47-Ai9-sgRNA2-CB-SaCas9; AAV9-Ai9-sgRNA1-CB-SaCas9; AAV9-CMV-SaCas9; AAVcc47-Ai9-sgRNA1 + sgRNA2; AAVcc47-CMV-SaCas9; AAV9-Ai9-sgRNA1 + sgRNA2; AAVcc47_pTR_self comp 2xU6-Ai9 guides; AAV9_pTR_self comp 2xU6-Ai9 guides; Projects Evolving High Potency AAV Vectors for Neuromuscular Genome Editing Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Ai14 mouse (congenic) Model System - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Ai9 SaCas9 Guide B Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium This gRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
ABE8e-Cas9 Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human, Rhesus macaque] Matched Fields: termSynonyms : Digestive tract epithelium Epithelium Endo-epithelium Unilaminar epithelium Foregut epithelium A-to-G base editor Show Experiments (3) Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Sontheimer Erik J Last Updated Date: 2021-10-01 Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
RRID:AB_1196615 Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: AB_1196615 RRID:AB_1196615 GFP (D5.1) XP Rabbit mAb antibody, Cell Signaling Technology Show Experiments (3) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center
AB_2209751 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: Rockland Cat# 600-401-379 AB_2209751 Anti-RFP (RABBIT) Antibody Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
AB_2532994 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: AB_2532994 13-0300 Thermo-Fisher, Rat anti-GFAP Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
AB_141607 Antibody - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Other Id: AB_141607 A21202 Invitrogen, Donkey anti-mouse alexafluor 488 Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
R2-modified Guide - [In Vivo, In Vitro] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium This gRNA targets the Ai9 and related transgenes Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Deverman_Comprehensive Methods Protocol - [In Vivo, In Vitro] [Delivery Systems] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium Procedure for plasmid cloning, editing evaluation in fibroblast, AAV production and administration, tissue processing and IHC. Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
L1-modified Guide - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: termSynonyms : Ecto-epithelium Epithelium This gRNA targets the Ai9 and related transgenes Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain

197 results for Epithelium

Category	Name	Description	Source	View Associated...
Project	Cas9 ribonucleoprotein delivery targeted to kidney epithelium			Show Experiments (1) Podocyte-specific gene editing in human kidney organoids
Experiment	Podocyte-specific gene editing in human kidney organoids	Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter.		Show Project Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Experiment	Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.	Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells.		Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Guide	sg298	This sgRNA targets the Ai9 and related transgenes at multiple sites	Synthego	Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Podocyte-specific gene editing in human kidney organoids
Genome Editor	GFP-NLS	Nuclear targeted GFP	Expressed From (Escherichia coli BL21DE3)	Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
Guide	g-loxP2_C9	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Guide	sgAi9L	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Vector	ssAAV5-sgB.saCas9		Gao Lab	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Experiment	Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia	In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells.		Show Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Antibody		Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody		Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Experiment	Testing AAV5 for activation of tdTomato in mouse airway	AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation		Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Genome Editor	SpCas9	HA-SV40NLS-SpCas9-SV40NLS	Vector Encoded	Show Experiments (4) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway A novel human T cell platform to define biological adverse effects of genome editing Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Vector	AAV.pU1a-SpCas9	Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS	Addgene Gao Lab	Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Vector	H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)	AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP	Addgene Gao Lab	Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Guide	g-loxPbot_C12a	This sgRNA targets the Ai9 and related transgenes at two sites	IDT	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Model System	BALB/c mouse	BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO).	The Jackson Laboratory	Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
Model System	mTmG mouse	ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence	The Jackson Laboratory	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Genome Editor	Cre recombinase	Cre recombinase delivered by AAV (see vector details)		Show Experiments (4) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Cre Recombinase dose escalation study in Ai9 mice Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Genome Editor	SaCas9		Vector Encoded (ssaav5-sga+sgb-u1a.gfp)	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Antibody		Anti-RFP (RABBIT) Antibody		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
Delivery System	S10	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (12) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Gene editing in vitro by various peptide variants delivering Cas12a in NK cells. Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Experiment	Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells	AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.		Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Antibody		Anti-RFP (Rabbit) Polyclonal Antibody		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody	RRID:AB_2717534	rabbit polyclonal antibody against the pulmonary-associated surfactant protein C (SPC), unconjugated, PA5-71680, Invitrogen		Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Model System	Ai9 mouse (BCM)	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	Baylor College of Medicine	Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Protocol	Heaney-SATC_Gao-Validation_Intratracheal Delivery of AAV in Mice	Procedure for Intratracheal (IT) delivery of AAV in mouse lung.		Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Protocol	Heaney_SATC Tissue Processing, Imaging and Analysis	Procedure for tissue preparation, imaging and analysis.		Show Experiments (4) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Delivery System	D237		McCray Lab	Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Guide	SpyCas9 g-loxP2_C9	This sgRNA targets the mTmG transgene	IDT	Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Genome Editor	Alt-R® S.p. Cas9 Nuclease V3	Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol.	Integrated DNA Technologies	Show Experiments (10) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia Validating Gene Editing Reporter 12 (GER12) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for NHEJ in Heterozygous Blastocysts Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 18 (GER18) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 19 (GER19) Mouse Model in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for HDR in Heterozygous Blastocysts Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Homozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
Vector	ssAAV5-spCas9		Gao Lab	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Guide	BCM_ssAAV5-Sp_sgA	This sgRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Protocol	Heaney-SATC_McCray-Validation_Intranasal Instillation in Mice Protocol	Procedure for intranasal instillation of ribonucleoprotein/peptide complex in mice for delivery to the lung.		Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Delivery System	D10		McCray Lab	Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Vector	ssAAV5-sgA+sgB-U1A.GFP		Gao Lab	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Experiment	[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice	AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Gao Validation (Gao, Guang-Ping )
Antibody	RRID:AB_2043201	anti-Wilms Tumor-1 (WT1)		Show Experiments (1) Podocyte-specific gene editing in human kidney organoids
Model System	mTmG mouse (congenic)	mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed.	The Jackson Laboratory	Show Experiments (7) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Model System	Ai9 mouse	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	The Jackson Laboratory	Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Model System	Ai9-SauSpyCas9 mouse	Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.	Baylor College of Medicine	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Experiment	Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway	We utilized novel amphiphilic shuttle peptides to deliver base editor ribonucleoprotein (RNP) into the airways to edit airway epithelial cells (CCR5 locus) of rhesus monkeys. The Cas9-ABE8e RNP and shuttle peptides S10 or FSD315 were aerosolized into the rhesus monkey trachea. Seven days later, tissues were obtained and dissected, and airway epithelia collected from the trachea, mainstem, and segmental bronchi using cytology brushes. DNA was extracted from epithelial cells and subjected to high-throughput sequencing. Using the FSD315 shuttle peptide and Cas9-ABE8e, we achieved a mean editing efficiency of 2.8% at the CCR5 locus in airway epithelial cells (range 0.02 – 5.3%) depending on the anatomic region sampled. To visualize the biodistribution of the RNPs within the respiratory tract and in specific cell types, we delivered a Cy5-fluorescent peptide fused to a nuclear localization signal (NLS-Cy5) using the S10 peptide. The lungs were obtained 1 and 2 hours post-delivery, fixed, and examined by microscopy. Epifluorescence and confocal microscopy documented an effective intra-nuclear delivery of NLS-Cy5 into epithelial cells throughout the respiratory tract, including large, medium, and small airways, and alveolar regions. Ongoing analyses will identify the NLS-Cy5-positive epithelial cell types using co-localization with fluorescently-labeled antibodies. In summary, using a rhesus monkey model, following a single delivery of adenine base editor RNPs to the airways in a clinically relevant manner we achieved up to 5.3% editing efficiency of the CCR5 locus in airway epithelia, a level considered therapeutically relevant in cystic fibrosis.		Show Project Base Editing in Rhesus Airway Epithelial
Model System	Macaca mulatta (Rhesus Macaque)		Tarantal Lab	Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Antibody		GFP (D5.1) XP Rabbit mAb antibody		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
Genome Editor	AsCas12a (IDT and Feldan Therapeutics)		IDT and Feldan Therapeutics	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Publication	Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia.	The delivery of biologic cargoes to airway epithelial cells is challenging due to the formidable barriers imposed by its specialized and differentiated cells. Among cargoes, recombinant proteins offer therapeutic promise but the lack of effective delivery methods limits their development. Here, we achieve protein and SpCas9 or AsCas12a ribonucleoprotein (RNP) delivery to cultured human well-differentiated airway epithelial cells and mouse lungs with engineered amphiphilic peptides. These shuttle peptides, non-covalently combined with GFP protein or CRISPR-associated nuclease (Cas) RNP, allow rapid entry into cultured human ciliated and non-ciliated epithelial cells and mouse airway epithelia. Instillation of shuttle peptides combined with SpCas9 or AsCas12a RNP achieves editing of loxP sites in airway epithelia of ROSAmT/mG mice. We observe no evidence of short-term toxicity with a widespread distribution restricted to the respiratory tract. This peptide-based technology advances potential therapeutic avenues for protein and Cas RNP delivery to refractory airway epithelial cells.
Vector	scAAV5-Cre-GFP		Gao Lab	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Guide	BCM_ssAAV5-Sa_sgB	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Guide	sgAi9R	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody		Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody	RRID:AB_477585	mouse monocolonal antibody against the acetylated α-tubulin, unconjugated, T6793, Sigma-Aldrich		Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Antibody	RRID:AB_310759	rabbit polyclonal antibody against club cell secretory protein, unconjugated, 07-623, EMD		Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Antibody	RRID:AB_2565050	rabbit polyclonal antibody to detect cytokeratin5+ basal cells, uncojugated, 905501, Biolegend		Show Experiments (1) Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Experiment	[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides	Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - McCray Validation (McCray Jr., Paul)
Genome Editor	SpCas9		IDT	Show Experiments (2) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Protocol	Heaney-SATC_McCray-Validation_Lung Inflation and Fixation Protocol	Procedure for mouse lung inflation and fixation.		Show Experiments (1) Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Guide	BCM_ssAAV5-Sp_sgB	This sgRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Vector	AAV9-Ai9-sgRNA1-CB-SaCas9	AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAVcc47-Ai9-sgRNA1 + sgRNA2	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Genome Editor	CleanCap® Fluc	Firefly luciferase mRNA capped using CleanCap. It is polyadenylated, modified with 5-methoxyuridine and optimized for mammalian systems. It mimics a fully processed mature mRNA.	Trilink Biotechnologies	Show Experiments (1) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.	A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Vector	AAV9_pTR_self comp 2xU6-Ai9 guides	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Vector	AAVcc47-Ai9-sgRNA1-CB-SaCas9	AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAVcc47_pTR_self comp 2xU6-Ai9 guides	AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Experiment	Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice	Delivery of firefly luciferase mRNA via new Lipid NanoParticles by tail vein injection into WT C57BL/6J mice targeting the Liver and delivery is measured by luciferase expression.		Show Project Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles
Protocol	Chaikof-Associated Protocol 2_Off-target editing AND Primers for sequencing analysis	This protocol describes in vivo adminstration and subsequent analysis of off-target editing in the liver.		Show Experiments (1) On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Experiment	Pcsk9 adenine base editor efficiency in liver and nonliver tissue	Adenine base editing at the Pcsk9 exon 1 splice donor site in mouse heart, kidney, liver, lungs, muscle, and spleen was assessed one week after systemic administration of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs) in C56BL/6 mice		Show Project Delivery Technologies for In Vivo Genome Editing
Genome Editor	TadA-8e V106W	Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W)	Chaikof Lab	Show Experiments (2) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Protocol	Chaikof-Associated Protocol 1_Retro-orbital administration and High throughput sequencing	This Protocol describes in vivo administration of BE-eVLP for Pcsk9 knockdown in liver, including sequencing endpoint.		Show Experiments (1) Pcsk9 adenine base editor efficiency in liver and nonliver tissue
Protocol	Chaikof-Associated Protocol 3_Serum ELISAs	This protocol describes in vivo adminstration and subsequent blood draws and ELISA on C57BL/6J mice.		Show Experiments (1) Pcsk9 adenine base editor efficiency in liver and nonliver tissue
Publication	Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins.	Methods to deliver gene editing agents in vivo as ribonucleoproteins could offer safety advantages over nucleic acid delivery approaches. We report the development and application of engineered DNA-free virus-like particles (eVLPs) that efficiently package and deliver base editor or Cas9 ribonucleoproteins. By engineering VLPs to overcome cargo packaging, release, and localization bottlenecks, we developed fourth-generation eVLPs that mediate efficient base editing in several primary mouse and human cell types. Using different glycoproteins in eVLPs alters their cellular tropism. Single injections of eVLPs into mice support therapeutic levels of base editing in multiple tissues, reducing serum Pcsk9 levels 78% following 63% liver editing, and partially restoring visual function in a mouse model of genetic blindness. In vitro and in vivo off-target editing from eVLPs was virtually undetected, an improvement over AAV or plasmid delivery. These results establish eVLPs as promising vehicles for therapeutic macromolecule delivery that combine key advantages of both viral and nonviral delivery.
Genome Editor	SaCas9-Lagor		William Lagor, Baylor College Of Medicine	Show Experiments (4) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Vector	AAV9-CMV-SaCas9	AAV serotype 9 delivering CMV driven SaCas9	Asokan Lab	Show Experiments (3) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Vector	AAVcc47-Ai9-sgRNA2-CB-SaCas9	AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAVcc47-CMV-SaCas9	AAVcc47 delivering CMV driven SaCas9	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Genome Editor	ABE8e	Tad8e deaminase fused to a nickase (D10A) spCas9	David Liu Lab	Show Experiments (1) Rhesus macaque CCR5 gRNA screening using ABE8e-Cas9
Vector	AAV4-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Guide	STS159 (mTmG; Sp_t2:Sp_c20_mTmG)	This sgRNA targets the mTmG transgene	in house production	Show Experiments (4) Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Vector	AAVcc47-CMV-Cre	AAVcc47 delivering CMV Cre Recombinase	Asokan Lab	Show Experiments (1) Cre Recombinase dose escalation study in Ai9 mice
Delivery System	eVLP	engineered virus like particles	Liu Lab	Show Experiments (3) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Vector	AAV7-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	demo VV01-Cre	DEMO viral vector for demo purpose	Virus Company X
Vector	demo VV05-Cre	DEMO viral vector for demo purpose	Virus Company X
Vector	AAV9-CMV-Cre	AAV serotype 9 delivering CMV Cre Recombinase	Asokan Lab	Show Experiments (1) Cre Recombinase dose escalation study in Ai9 mice
Vector	AAVcc47-Cre	AAV2/5 expressing Cre recombinase	Asokan Lab	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Antibody	RRID:AB_2633281	Goat anti-rabbit IgG-Alexa Fluor 555
Antibody	RRID:AB_141637			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_2937041	Chicken Polyclonal anti-NeuN antibody
Guide	Pcsk9 Exon 1 splice domain	Pcsk9 Exon 1 splice domain	Synthego	Show Experiments (2) Pcsk9 adenine base editor efficiency in liver and nonliver tissue Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Model System	B6	C57BL/6J WT mouse	Baylor College of Medicine	Show Experiments (1) Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Model System	C57BL/6J mouse	C57BL/6J WT mouse	The Jackson Laboratory	Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Experiment	[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain	Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed.		Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Gong, Submission 2 (On- and Off-target data)
Delivery System	RNP-NC-CPP	The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity	Gong Lab	Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Antibody	RRID:AB_10711040			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Experiment	AAV Tropism project	Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging		Show Project SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice
Experiment	Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing	Heterozygous embryos containing the traffic light reporter 2 (TLR-2) reporter at the Rosa26 locus were evaluated for activation potential following electroporation of two guide/RNP combinations and transfer to pseudo-pregnant hosts for development to term. Offspring (founders) with activating edits were mated to wild-type females and adult tissues from progeny were assessed for tagRFP fluorescence.		Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - TLR2 small animal reporter, submission 2 (Tier 1 & 2 validation)
Genome Editor	SpyCas9-3xNLS	SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal	Sontheimer lab	Show Experiments (7) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Vector	AAV3b-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAV5-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAV6-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAVrh74-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	demo VV03-Cre	DEMO viral vector for demo purpose	Virus Company X
Guide	R26-2		IDT	Show Experiments (3) Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Homozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
Guide	R26-52		IDT	Show Experiments (2) Validating Traffic Light Reporter 2 (TLR2) Mouse Model in Heterozygous Blastocysts using SpCas9 Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
Guide	STS204 (DNMT1; Sp_t2:Sp_c20_Dnmt1)	For endogenous locus	in house production	Show Experiments (2) Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Delivery System	306-O12B	Combinatorial library cationic lipid nanoparticles	Xu lab	Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Experiment	On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver	On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10.		Show Project Delivery Technologies for In Vivo Genome Editing
Vector	AAV-Pcsk9			Show Experiments (1) On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Experiment	Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.	C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Vector	AAV9-GFP	AAV2/9 self complementary vector expressing GFP driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Vector	AAV9-mCherry	AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Genome Editor	CleanCap® Cas9 mRNA (5moU)	SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA.	Trilink Biotechnologies	Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Delivery System	RNP-NC-no ligand	The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA.	Gong Lab	Show Experiments (4) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Delivery System	RNP-NC-RVG	The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry	Gong Lab	Show Experiments (2) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Guide	Ai14 gRNA	This sgRNA targets the Ai9 and related transgenes at multiple sites	IDT	Show Experiments (3) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_2209751			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Model System	C57BL/6 mouse (Asokan study)		Unspecified	Show Experiments (2) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)	A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)	A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Antibody	RRID:AB_141607	Alexa fluor 488, Donkey anti-mouse
Delivery System	306-S10	combinatorial library cationic lipid nanoparticles	Xu lab	Show Experiments (5) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Vector	AAVcc47-SaCas9-Ai9	AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter	Asokan Lab	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Experiment	[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.	Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Asokan Validation (Asokan, Aravind)
Genome Editor	SauCas9			Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Guide	Ai9 SaCas9 Guide A	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Delivery System	113-O12B	combinatorial library cationic lipid nanoparticles	Xu lab	Show Experiments (2) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
Vector	AAVcc84-GFP	AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Experiment	Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.	C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Vector	AAVcc47-mCherry	AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Vector	AAVcc81-GFP	AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Vector	AAV9-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Antibody	RRID:AB_10563941	Polyclonal rabbit anti-RFP antibody		Show Experiments (1) Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
Experiment	[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver	Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced.		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Chaikof Validation (Chaikof, Elliot L. )
Genome Editor	ABE8e	Catalytically impaired Cas fused to TadA deaminase	Liu Lab	Show Experiments (1) Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Experiment	Cre Recombinase dose escalation study in Ai9 mice	A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Model System	TLR-2 mouse	R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways.	The Jackson Laboratory	Show Experiments (1) Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing
Delivery System	FSD315	Shuttle peptide used to deliver reagents to airway epithelia	McCray Lab	Show Experiments (7) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Inhibitory effect of Cas9 RNP alone on S10- or FSDS315-mediated GFP protein delivery to HeLa cells Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Experiment	[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear	Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed.		Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data)
Genome Editor	sNLS-SpCas9-sNLS	SpCas9 with N- and C-terminal SV40 NLS	Aldevron 9212-5MG	Show Experiments (6) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Testing different ratios of Lipofectamine-RNPs after 24 hours for determination of positive control Imaging quantification of transfection efficiency with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on the liver-on-chip model system Quantification of transfection efficiency by flow cytometry with varying dosages of nanoparticles encapsulated with Cas9/sgRNA RNP on liver-on-chip model system
Antibody	RRID:AB_2762843	Goat anti-chicken IgG-Alexa Fluor 488
Antibody	RRID:AB_2813835			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_141607			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Guide	gRNA #8		IDT	Show Experiments (2) Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Genome Editor	SaCas9		Leong Lab	Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Delivery System	AAV+Focused Ultrasound	See vector details	Leong Lab	Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Antibody	RRID:AB_10711040	Mouse monoclonal [1B7] to NeuN - Neuronal Marker
Antibody	RRID:AB_2762834	Alexa fluor 555, Donkey anti-rabbit
Experiment	[Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain	Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections.		Show Project The Jackson Laboratory Gene Editing Testing Center - Sontheimer Validation (Sontheimer, Eric)
Experiment	Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.	Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression.		Show Project Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain
Protocol	Gong_Intracranial Injection Procedure for Mice	Procedure for intracranial delivery to mouse brain.		Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Experiment	[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain	Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice		Show Project The Jackson Laboratory Gene Editing Testing Center - Gong Validation (Gong, Shaoqin)
Protocol	Murray-SATC_Gong-Validation Brain Injection in Mice Protocol	Procedure for brain injection surgical procedure, pre- and post-operative care for mice.		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Protocol	Murray-SATC_Gong-Validaiton_Gong Study Protocol	Procedure for intracranial injection, immunofluorescence and imaging.		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	AB_141637	Invitrogen, Donkey anti-rabbit alexa fluor 594		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	AB_2813835	Abcam, Donkey anti-rat alexa fluour 647		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Model System	Ai14 mouse	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Experiment	[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear	Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice		Show Project The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi)
Antibody	AB_10711040	Abcam, mouse anti-NeuN		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Experiment	[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear	Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice		Show Project The Jackson Laboratory Gene Editing Testing Center - Chen Validation (Chen, Zheng-Yi)
Delivery System	306-O12B blank	Combinatorial library cationic lipid nanoparticles	Xu lab	Show Experiments (2) Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Experiment	[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear	Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal.		Show Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) - SATC-Chen, Submission 2 (On- and Off-target data)
Experiment	Testing gRNA sequence and gRNA scaffold modified in Ai9 mice.	3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later.		Show Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System
Guide	L2-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (2) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Experiment	[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain	Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Deverman Validation (Deverman, Benjamin)
Genome Editor	SaCas9			Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Vector	BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2	Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds	Deverman Lab	Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Vector	BI28:AAV-GFAP-SaCas9-WPRE3-pA	Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter	Deverman Lab	Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Protocol	Deverman_Area Based Quantification of Editing Efficiency Protocol	Procedure for non-IHC based image quantification of editing.		Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Experiment	Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea	Delivery of Cas9/sgRNA mRNA via new LNPs to the cochlea by cochleostomy and gene editing is measured by percentage of tdTomato positive cells.		Show Project Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles
Antibody	AB_2286684	Sox-2 (Y-17) Antibody, Santa Cruz Biotechnology		Show Experiments (1) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
Genome Editor	CleanCap® Cas9	SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA.	Trilink Biotechnologies	Show Experiments (2) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in primary fibroblast cells from adult Ai14 mouse cochlea Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
Antibody	AB_10015251	Anti-Myosin VIIa antibody, Proteus Biosciences		Show Experiments (1) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea
Experiment	Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)	A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Vector	AAV9-Ai9-sgRNA1 + sgRNA2	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Vector	AAV9-Ai9-sgRNA2-CB-SaCas9	AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAV8-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAVrh10-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAVrh8-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	demo VV02-Cre	DEMO viral vector for demo purpose	Virus Company X
Vector	demo VV04-Cre	DEMO viral vector for demo purpose	Virus Company X
Antibody	RRID:AB_2536526	GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362		Show Experiments (3) Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Antibody	RRID:AB_2313606	Vector Labs Goat Anti-Rabbit IgG Biotinylated Cat. #BA-1000		Show Experiments (1) Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Guide	sg298	This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases	Synthego	Show Experiments (4) Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear
Antibody	RRID:AB_2532994			Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Delivery System	AAV	See vector details		Show Experiments (9) Cre Recombinase dose escalation study in Ai9 mice AAV Tropism project AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids. Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Publication	Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing.	Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attributes benchmarked against AAV serotype 9 as evidenced by robust reporter and therapeutic gene expression, Cre recombination and CRISPR genome editing in normal and diseased mouse models. Enhanced transduction efficiency of AAV.cc47 vectors is further corroborated in macaques and pigs, providing a strong rationale for potential clinical translation into human gene therapies. We envision that ccAAV vectors may not only improve predictive modeling in preclinical studies, but also clinical translatability by broadening the therapeutic window of AAV based gene therapies.
Model System	Ai14 mouse (congenic)	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Guide	Ai9 SaCas9 Guide B	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Genome Editor	ABE8e-Cas9	A-to-G base editor	Feldan Therapeutics	Show Experiments (3) Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting B2M locus Delivery of ABE8e-Cas9 RNP using Shuttle peptide candidates to rhesus monkey airway epithelial cells cultured at the air liquid interface targeting CCR5 locus. Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway
Experiment	Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center	Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain		Show Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors
Antibody	RRID:AB_1196615	GFP (D5.1) XP Rabbit mAb antibody, Cell Signaling Technology		Show Experiments (3) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center
Antibody	AB_2209751	Anti-RFP (RABBIT) Antibody		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	AB_2532994	Thermo-Fisher, Rat anti-GFAP		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Antibody	AB_141607	Invitrogen, Donkey anti-mouse alexafluor 488		Show Experiments (1) Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Guide	R2-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Protocol	Deverman_Comprehensive Methods	Procedure for plasmid cloning, editing evaluation in fibroblast, AAV production and administration, tissue processing and IHC.		Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	L1-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain

Contact SCGE

197 results for Epithelium

Select Category

OR Filter By ...

197 results for Epithelium

RRID:AB_2717534

[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

RRID:AB_2043201

46. Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia.

RRID:AB_477585

RRID:AB_310759

RRID:AB_2565050

[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides

71. Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins.

RRID:AB_2633281

RRID:AB_141637

RRID:AB_2937041

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

RRID:AB_10711040

RRID:AB_2209751

RRID:AB_141607

[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.

RRID:AB_10563941

[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver

[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

RRID:AB_2762843

RRID:AB_2813835

RRID:AB_141607