186 results for Epithelium
186 results for Epithelium
Cas9 ribonucleoprotein delivery targeted to kidney epitheliumProject - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects]Show Experiments (1) |
|
Other Id:
Abcam (ab89901)
anti-Wilms Tumor-1 (WT1) Show Experiments (1) |
Podocyte-specific gene editing in human kidney organoidsExperiment - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects] |
Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic PeptidesProject - [In Vivo, In Vitro] [Delivery Systems]
Show Experiments (6)
|
H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)Vector - [In Vivo] [Mouse] |
Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung DiseasesProject - [In Vivo, In Vitro] [Delivery Systems]
|
Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epitheliaExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
g-loxPbot_C12aGuide - [In Vivo] [Mouse] |
AAV.pU1a-SpCas9Vector - [In Vivo] [Mouse] |
Testing AAV5 for activation of tdTomato in mouse airwayExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cellsExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
Antibody - [In Vivo] [Mouse]GFP (D5.1) XP Rabbit mAb antibody Show Experiments (1) |
AsCas12a (IDT and Feldan Therapeutics)Genome Editor - [In Vivo] [Mouse] |
BALB/c mouseModel System - [In Vivo] [Mouse]Show Experiments (1) |
mTmG mouseModel System - [In Vivo] [Mouse] |
Antibody - [In Vivo] [Mouse]Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300 Show Experiments (1) |
Antibody - [In Vivo] [Mouse]Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000 Show Experiments (1) |
Antibody - [In Vivo] [Mouse]Anti-RFP (RABBIT) Antibody Show Experiments (1) |
Alt-R™ S.p. Cas9 Nuclease V3Genome Editor - [In Vivo, In Vitro] [Mouse]Show Experiments (10)
|
mTmG mouse (congenic)Model System - [In Vivo] [Mouse]Show Experiments (7)
|
ssAAV5-sgA+sgB-U1A.GFPVector - [In Vivo] [Mouse] |
ssAAV5-spCas9Vector - [In Vivo] [Mouse] |
Ai9-SauSpyCas9 mouseModel System - [In Vivo] [Mouse] |
D10Delivery System - [In Vivo] [Mouse] |
D237Delivery System - [In Vivo] [Mouse] |
[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 miceExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
SpCas9Genome Editor - [In Vivo] [Mouse] |
scAAV5-Cre-GFPVector - [In Vivo] [Mouse] |
BCM-Rice Resource for the Analysis of Somatic Gene Editing in MiceProject - [In Vivo] [Animal Reporter and Testing Center]
Show Experiments (5)
|
Cre recombinaseGenome Editor - [In Vivo, In Vitro] [Mouse]Show Experiments (4)
|
[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic PeptidesExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
SaCas9Genome Editor - [In Vivo] [Mouse] |
|
Other Id:
07-623
T6793
PA5-71680
905501.0
rabbit polyclonal antibody against club cell secretory protein, unconjugated, 07-623, EMD Show Experiments (1) |
FSD315Delivery System - [In Vivo, In Vitro] [Human, Mouse, Rhesus macaque]Show Experiments (7)
|
|
Other Id:
07-623
T6793
PA5-71680
905501.0
mouse monocolonal antibody against the acetylated α-tubulin, unconjugated, T6793, Sigma-Aldrich Show Experiments (1) |
Macaca mulatta (Rhesus Macaque)Model System - [In Vivo] [Rhesus macaque]Show Experiments (1) |
sg298Guide - [In Vivo, In Vitro] [Mouse]Show Experiments (3) |
ABE8e-Cas9Genome Editor - [In Vivo, In Vitro] [Human, Rhesus macaque]Show Experiments (3)
|
|
Other Id:
07-623
T6793
PA5-71680
905501.0
rabbit polyclonal antibody against the pulmonary-associated surfactant protein C (SPC), unconjugated, PA5-71680, Invitrogen Show Experiments (1) |
gRNA #8Guide - [In Vivo, In Vitro] [Rhesus macaque] |
Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey AirwayExperiment - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque]Show Project |
SaCas9-LagorGenome Editor - [In Vivo] [Mouse]Show Experiments (4)
|
AAV9-Ai9-sgRNA1 + sgRNA2Vector - [In Vivo] [Mouse] |
AAVcc47-Ai9-sgRNA1 + sgRNA2Vector - [In Vivo] [Mouse] |
eVLPDelivery System - [In Vivo] [Mouse]Show Experiments (3)
|
|
Other Id:
Invitrogen, R10367
Polyclonal rabbit anti-RFP antibody Show Experiments (1) |
AAV5-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAV7-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAV8-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
R26-2Guide - [In Vivo, In Vitro] [Mouse] |
AAVrh74-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAV9-CMV-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
CleanCap® Cas9 mRNA (5moU)Genome Editor - [In Vivo] [Mouse]Show Experiments (4)
|
|
|
|
|
Antibody - [In Vivo] [Mouse]Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200 Show Experiments (1) |
Antibody - [In Vivo] [Mouse]Anti-RFP (Rabbit) Polyclonal Antibody Show Experiments (1) |
306-S10Delivery System - [In Vivo, In Vitro] [Mouse]Show Experiments (5)
|
AAVcc84-GFPVector - [In Vivo] [Mouse] |
S10Delivery System - [In Vivo, In Vitro] [Human, Mouse, Rhesus macaque]Show Experiments (12)
|
Base Editing in Rhesus Airway EpithelialProject - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund]Show Experiments (7)
|
|
Other Id:
07-623
T6793
PA5-71680
905501.0
rabbit polyclonal antibody to detect cytokeratin5+ basal cells, uncojugated, 905501, Biolegend Show Experiments (1) |
Ai9 mouse (BCM)Model System - [In Vivo] [Mouse] |
ssAAV5-sgB.saCas9Vector - [In Vivo] [Mouse] |
AAVcc47-Ai9-sgRNA1-CB-SaCas9Vector - [In Vivo] [Mouse] |
AAVcc47-Ai9-sgRNA2-CB-SaCas9Vector - [In Vivo] [Mouse] |
Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intramuscular administration to rhesus macaquesExperiment - [In Vivo] [Delivery Systems]
|
Ai9 mouseModel System - [In Vivo] [Mouse]Show Experiments (11)
|
Pcsk9 adenine base editor efficiency in liver and nonliver tissueExperiment - [In Vivo] [Delivery Systems] [Mouse]
Show Project |
Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intravenous administration to rhesus macaquesExperiment - [In Vivo] [Delivery Systems]
|
TadA-8e V106WGenome Editor - [In Vivo] [Mouse] |
Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline EditingExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
AAV9-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAVrh10-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
Cre Recombinase dose escalation study in Ai9 miceExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
sNLS-SpCas9-sNLSGenome Editor - [In Vivo, In Vitro] [Mouse]Show Experiments (6)
|
|
|
RNP-NC-RVGDelivery System - [In Vivo] [Mouse] |
Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult miceExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
AAV9-GFPVector - [In Vivo] [Mouse] |
AAV9-CMV-SaCas9Vector - [In Vivo] [Mouse]Show Experiments (3)
|
[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
Evolving High Potency AAV Vectors for Neuromuscular Genome EditingProject - [In Vivo] [Delivery Systems]
Show Experiments (9)
|
AAV4-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAV6-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
R26-52Guide - [In Vivo, In Vitro] [Mouse] |
|
|
AAVDelivery System - [In Vivo, In Vitro] [Human, Mouse]Show Experiments (10)
|
Ai14 mouse (congenic)Model System - [In Vivo] [Mouse]Show Experiments (7)
|
Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
|
Other Id:
Ab104224
Rockland Cat# 600-401-379
A21202
Ab150155
A21207
13-0300
Anti-RFP (RABBIT) Antibody |
|
Other Id:
Ab104224
Rockland Cat# 600-401-379
A21202
Ab150155
A21207
13-0300
Invitrogen, Donkey anti-mouse alexafluor 488 |
[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
CleanCap® FlucGenome Editor - [In Vivo] [Mouse]Show Experiments (1) |
On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liverExperiment - [In Vivo] [Delivery Systems] [Mouse]
Show Project |
AAV-Pcsk9Vector - [In Vivo] [Mouse] |
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
AAV9-Ai9-sgRNA1-CB-SaCas9Vector - [In Vivo] [Mouse] |
AAVcc47_pTR_self comp 2xU6-Ai9 guidesVector - [In Vivo] [Mouse] |
[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner earExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
Delivery Technologies for In Vivo Genome EditingProject - [In Vivo] [Delivery Systems]
|
[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liverExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
AAV3b-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
TLR-2 mouseModel System - [In Vivo] [Mouse]Show Experiments (1) |
AAVrh8-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAVcc47-CMV-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner earExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
RNP-NC-CPPDelivery System - [In Vivo, In Vitro] [Mouse]Show Experiments (6)
|
The Jackson Laboratory Gene Editing Testing Center (JAX-GETC)Project - [In Vivo, In Vitro] [Animal Reporter and Testing Center]
Show Experiments (18)
|
AAV9-mCherryVector - [In Vivo] [Mouse] |
SauCas9Genome Editor - [In Vivo] [Mouse] |
AAVcc47-SaCas9-Ai9Vector - [In Vivo] [Mouse] |
BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2Vector - [In Vivo] [Mouse] |
BI28:AAV-GFAP-SaCas9-WPRE3-pAVector - [In Vivo] [Mouse] |
STS159 (mTmG; Sp_t2:Sp_c20_mTmG)Guide - [In Vivo, In Vitro] [Mouse]Show Experiments (4)
|
Ai14 mouseModel System - [In Vivo] [Mouse] |
Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the BrainProject - [In Vivo] [Delivery Systems]
|
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
AAV9-Ai9-sgRNA2-CB-SaCas9Vector - [In Vivo] [Mouse] |
AAV9_pTR_self comp 2xU6-Ai9 guidesVector - [In Vivo] [Mouse] |
AAV9-SaCas9/guide DMDVector - [In Vivo] |
AAVcc47-SaCas9/guide DMDVector - [In Vivo] |
[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner earExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
|
Other Id:
Thermo Fisher Scientific Cat# G10362
Vector Labs Cat# BA-1000
GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362 Show Experiments (3)
|
|
Other Id:
Thermo Fisher Scientific Cat# G10362
Vector Labs Cat# BA-1000
Vector Labs Goat Anti-Rabbit IgG Biotinylated Cat. #BA-1000 |
AAV Tropism projectExperiment - [In Vivo] [AAV tropism] [Mouse] |
SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in MiceProject - [In Vivo] [AAV tropism]Show Experiments (1) |
Ai14 gRNAGuide - [In Vivo] [Mouse]Show Experiments (3)
|
|
|
|
|
sg298Guide - [In Vivo] [Mouse]Show Experiments (4)
|
RNP-NC-no ligandDelivery System - [In Vivo, In Vitro] [Mouse]Show Experiments (4)
|
306-O12BDelivery System - [In Vivo, In Vitro] [Mouse]Show Experiments (7)
|
Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid NanoparticlesProject - [In Vivo, In Vitro] [Delivery Systems]
Show Experiments (3)
|
Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
AAVcc47-mCherryVector - [In Vivo] [Mouse] |
AAVcc81-GFPVector - [In Vivo] [Mouse] |
L1-modifiedGuide - [In Vivo, In Vitro] [Mouse]Show Experiments (3) |
[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
|
Other Id:
25-6790
Sc-17320
Anti-Myosin VIIa antibody, Proteus Biosciences |
|
Other Id:
25-6790
Sc-17320
Sox-2 (Y-17) Antibody, Santa Cruz Biotechnology |
Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous SystemProject - [In Vivo, In Vitro] [Delivery Systems]
|
Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing CenterExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and DonorsProject - [In Vivo, In Vitro] [Delivery Systems]
Show Experiments (11)
|
SpyCas9-3xNLSGenome Editor - [In Vivo, In Vitro] [Human, Mouse]Show Experiments (7)
|
|
Other Id:
Ab104224
Rockland Cat# 600-401-379
A21202
Ab150155
A21207
13-0300
Thermo-Fisher, Rat anti-GFAP |
|
Other Id:
Ab104224
Rockland Cat# 600-401-379
A21202
Ab150155
A21207
13-0300
Abcam, mouse anti-NeuN |
|
Other Id:
Ab104224
Rockland Cat# 600-401-379
A21202
Ab150155
A21207
13-0300
Invitrogen, Donkey anti-rabbit alexa fluor 594 |
|
Other Id:
Ab104224
Rockland Cat# 600-401-379
A21202
Ab150155
A21207
13-0300
Abcam, Donkey anti-rat alexa fluour 647 |
Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochleaExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
306-O12B blankDelivery System - [In Vivo] [Mouse] |
[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner earExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
Testing gRNA sequence and gRNA scaffold modified in Ai9 mice.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
SaCas9Genome Editor - [In Vivo, In Vitro] [Mouse]Show Experiments (3) |
|
Other Id:
AB_1196615
GFP (D5.1) XP Rabbit mAb antibody, Cell Signaling Technology Show Experiments (3)
|
[Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
CleanCap® Cas9Genome Editor - [In Vivo, In Vitro] [Mouse] |
186 results for Epithelium
| Category | Name | Description | Source | View Associated... |
|---|---|---|---|---|
| Project | Cas9 ribonucleoprotein delivery targeted to kidney epithelium |
Show Experiments (1) |
||
| Antibody | RRID:AB_2043201 | anti-Wilms Tumor-1 (WT1) |
Show Experiments (1) |
|
| Experiment | Podocyte-specific gene editing in human kidney organoids | Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter. | ||
| Experiment | Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. | Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells. | ||
| Project | Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides | The proposed research is relevant to the public health because genetic and acquired diseases affecting the airways pose major disease and economic burdens. By advancing the delivery of gene editing tools, it may be possible to therapeutically modify the cells lining the airways. This novel strategy has implications for the treatment of both monogenetic and acquired lungs disease, and may have applications for other somatic cell therapies. |
Show Experiments (6)
|
|
| Guide | g-loxP2_C9 | This sgRNA targets the Ai9 and related transgenes | IDT | |
| Vector | H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) | AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP | Gao Lab | |
| Project | Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases | Efficacy and safety limitations in current gene editing technologies have hindered efforts to treat genetic lung diseases. This proposal seeks to develop and validate a combinatorial delivery approach that uses non-viral and viral vehicles to efficiently transport gene editing tools to disease-relevant cells in the lung. Completion of our work will establish safe and effective delivery vehicles that will guide the design of future gene therapies for genetic disorders. | ||
| Genome Editor | SpCas9 | HA-SV40NLS-SpCas9-SV40NLS | Vector Encoded | |
| Guide | sgAi9L | This sgRNA targets the Ai9 and related transgenes | IDT | |
| Guide | sgAi9R | This sgRNA targets the Ai9 and related transgenes | IDT | |
| Experiment | Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia | In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells. | ||
| Guide | g-loxPbot_C12a | This sgRNA targets the Ai9 and related transgenes at two sites | IDT | |
| Vector | AAV.pU1a-SpCas9 | Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS | Addgene | |
| Experiment | Testing AAV5 for activation of tdTomato in mouse airway | AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation | ||
| Experiment | Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells | AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types. | ||
| Antibody | GFP (D5.1) XP Rabbit mAb antibody |
Show Experiments (1) |
||
| Genome Editor | AsCas12a (IDT and Feldan Therapeutics) | IDT and Feldan Therapeutics | ||
| Genome Editor | GFP-NLS | Nuclear targeted GFP | Expressed From (Escherichia coli BL21DE3) |
Show Experiments (1) |
| Model System | BALB/c mouse | BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). | The Jackson Laboratory |
Show Experiments (1) |
| Model System | mTmG mouse | ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence | The Jackson Laboratory | |
| Antibody | Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300 |
Show Experiments (1) |
||
| Antibody | Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000 |
Show Experiments (1) |
||
| Antibody | Anti-RFP (RABBIT) Antibody |
Show Experiments (1) |
||
| Genome Editor | Alt-R™ S.p. Cas9 Nuclease V3 | Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. | Integrated DNA Technologies (IDT) |
Show Experiments (10)
|
| Model System | mTmG mouse (congenic) | mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. | The Jackson Laboratory |
Show Experiments (7)
|
| Vector | ssAAV5-sgA+sgB-U1A.GFP | Gao Lab | ||
| Vector | ssAAV5-spCas9 | Gao Lab | ||
| Model System | Ai9-SauSpyCas9 mouse | Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. | Baylor College of Medicine | |
| Delivery System | D10 | McCray Lab | ||
| Delivery System | D237 | McCray Lab | ||
| Experiment | [Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice | AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway | ||
| Genome Editor | SpCas9 | IDT | ||
| Vector | scAAV5-Cre-GFP | Gao Lab | ||
| Project | BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice | Genome editing systems have the potential to cure some of the most severe human diseases. However, there are significant efficacy and safety issues that must be addressed before this technology can be applied in clinical trials. The BCM-Rice Resource Center for the Analysis of Somatic Gene Editing in Mice will create mouse reporter models for testing genome editing technologies, and to use these animal models to test genome editing delivery technologies and new genome editors developed by other Somatic Cell Genome Editing program members. |
Show Experiments (5)
|
|
| Genome Editor | Cre recombinase | Cre recombinase delivered by AAV (see vector details) |
Show Experiments (4)
|
|
| Experiment | [Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides | Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings | ||
| Guide | SpyCas9 g-loxP2_C9 | This sgRNA targets the mTmG transgene | IDT | |
| Guide | BCM_ssAAV5-Sa_sgB | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Genome Editor | SaCas9 | Vector Encoded (ssaav5-sga+sgb-u1a.gfp) | ||
| Antibody | RRID:AB_310759 | rabbit polyclonal antibody against club cell secretory protein, unconjugated, 07-623, EMD |
Show Experiments (1) |
|
| Delivery System | FSD315 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (7)
|
| Antibody | RRID:AB_477585 | mouse monocolonal antibody against the acetylated α-tubulin, unconjugated, T6793, Sigma-Aldrich |
Show Experiments (1) |
|
| Model System | Macaca mulatta (Rhesus Macaque) | Tarantal Lab |
Show Experiments (1) |
|
| Guide | sg298 | This sgRNA targets the Ai9 and related transgenes at multiple sites | Synthego |
Show Experiments (3) |
| Genome Editor | ABE8e-Cas9 | A-to-G base editor | Feldan Therapeutics |
Show Experiments (3)
|
| Antibody | RRID:AB_2717534 | rabbit polyclonal antibody against the pulmonary-associated surfactant protein C (SPC), unconjugated, PA5-71680, Invitrogen |
Show Experiments (1) |
|
| Guide | gRNA #8 | IDT | ||
| Experiment | Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway | We utilized novel amphiphilic shuttle peptides to deliver base editor ribonucleoprotein (RNP) into the airways to edit airway epithelial cells (CCR5 locus) of rhesus monkeys. The Cas9-ABE8e RNP and shuttle peptides S10 or FSD315 were aerosolized into the rhesus monkey trachea. Seven days later, tissues were obtained and dissected, and airway epithelia collected from the trachea, mainstem, and segmental bronchi using cytology brushes. DNA was extracted from epithelial cells and subjected to high-throughput sequencing. Using the FSD315 shuttle peptide and Cas9-ABE8e, we achieved a mean editing efficiency of 2.8% at the CCR5 locus in airway epithelial cells (range 0.02 – 5.3%) depending on the anatomic region sampled. To visualize the biodistribution of the RNPs within the respiratory tract and in specific cell types, we delivered a Cy5-fluorescent peptide fused to a nuclear localization signal (NLS-Cy5) using the S10 peptide. The lungs were obtained 1 and 2 hours post-delivery, fixed, and examined by microscopy. Epifluorescence and confocal microscopy documented an effective intra-nuclear delivery of NLS-Cy5 into epithelial cells throughout the respiratory tract, including large, medium, and small airways, and alveolar regions. Ongoing analyses will identify the NLS-Cy5-positive epithelial cell types using co-localization with fluorescently-labeled antibodies. In summary, using a rhesus monkey model, following a single delivery of adenine base editor RNPs to the airways in a clinically relevant manner we achieved up to 5.3% editing efficiency of the CCR5 locus in airway epithelia, a level considered therapeutically relevant in cystic fibrosis. |
Show Project |
|
| Genome Editor | SaCas9-Lagor | William Lagor, Baylor College Of Medicine |
Show Experiments (4)
|
|
| Vector | AAV9-Ai9-sgRNA1 + sgRNA2 | AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAVcc47-Ai9-sgRNA1 + sgRNA2 | AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus | Asokan Lab | |
| Model System | C57BL/6J mouse | C57BL/6J WT mouse | The Jackson Laboratory |
Show Experiments (3) |
| Genome Editor | ABE8e | Catalytically impaired Cas fused to TadA deaminase | Liu Lab | |
| Delivery System | eVLP | engineered virus like particles | Liu Lab |
Show Experiments (3)
|
| Antibody | RRID:AB_10563941 | Polyclonal rabbit anti-RFP antibody |
Show Experiments (1) |
|
| Vector | AAV5-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAV7-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAV8-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Guide | R26-2 | IDT | ||
| Vector | AAVrh74-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAV9-CMV-Cre | AAV serotype 9 delivering CMV Cre Recombinase | Asokan Lab |
Show Experiments (1) |
| Experiment | [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain | Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed. | ||
| Genome Editor | CleanCap® Cas9 mRNA (5moU) | SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. | Trilink Biotechnologies |
Show Experiments (4)
|
| Antibody | RRID:AB_2209751 | |||
| Antibody | RRID:AB_10711040 | |||
| Antibody | Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200 |
Show Experiments (1) |
||
| Antibody | Anti-RFP (Rabbit) Polyclonal Antibody |
Show Experiments (1) |
||
| Delivery System | 306-S10 | combinatorial library cationic lipid nanoparticles | Xu lab |
Show Experiments (5)
|
| Vector | AAVcc84-GFP | AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter | Asokan Lab | |
| Delivery System | S10 | Shuttle peptide used to deliver reagents to airway epithelia | McCray Lab |
Show Experiments (12)
|
| Vector | AAVcc47-Cre | AAV2/5 expressing Cre recombinase | Asokan Lab | |
| Project | Base Editing in Rhesus Airway Epithelial |
Show Experiments (7)
|
||
| Antibody | RRID:AB_2565050 | rabbit polyclonal antibody to detect cytokeratin5+ basal cells, uncojugated, 905501, Biolegend |
Show Experiments (1) |
|
| Guide | BCM_ssAAV5-Sp_sgA | This sgRNA targets the Ai9 and related transgenes | Vector encoded | |
| Model System | Ai9 mouse (BCM) | Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. | Baylor College of Medicine | |
| Guide | BCM_ssAAV5-Sp_sgB | This sgRNA targets the Ai9 and related transgenes | Vector encoded | |
| Vector | ssAAV5-sgB.saCas9 | Gao Lab | ||
| Vector | AAVcc47-Ai9-sgRNA1-CB-SaCas9 | AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAVcc47-Ai9-sgRNA2-CB-SaCas9 | AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAVcc47-CMV-SaCas9 | AAVcc47 delivering CMV driven SaCas9 | Asokan Lab | |
| Experiment | Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intramuscular administration to rhesus macaques | Phase II, AAV9 (n=4) and AAVcc47 (n=4) were administered via intramuscular injection in rhesus macaques and organs were harvested 4 weeks post injection. | ||
| Model System | Ai9 mouse | Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. | The Jackson Laboratory |
Show Experiments (11)
|
| Experiment | Pcsk9 adenine base editor efficiency in liver and nonliver tissue | Adenine base editing at the Pcsk9 exon 1 splice donor site in mouse heart, kidney, liver, lungs, muscle, and spleen was assessed one week after systemic administration of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs) in C56BL/6 mice |
Show Project |
|
| Experiment | Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intravenous administration to rhesus macaques | Phase I, AAV9 (n=4) and AAVcc47 (n=4) were administered via intravenous injection in rhesus macaques and organs were harvested 4 weeks post injection. | ||
| Genome Editor | TadA-8e V106W | Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W) | Chaikof Lab | |
| Experiment | Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing | Heterozygous embryos containing the traffic light reporter 2 (TLR-2) reporter at the Rosa26 locus were evaluated for activation potential following electroporation of two guide/RNP combinations and transfer to pseudo-pregnant hosts for development to term. Offspring (founders) with activating edits were mated to wild-type females and adult tissues from progeny were assessed for tagRFP fluorescence. | ||
| Vector | AAV9-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAVrh10-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Experiment | Cre Recombinase dose escalation study in Ai9 mice | A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images. | ||
| Genome Editor | sNLS-SpCas9-sNLS | SpCas9 with N- and C-terminal SV40 NLS | Aldevron 9212-5MG |
Show Experiments (6)
|
| Antibody | RRID:AB_141607 | |||
| Delivery System | RNP-NC-RVG | The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry | Gong Lab | |
| Experiment | Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice | Delivery of firefly luciferase mRNA via new Lipid NanoParticles by tail vein injection into WT C57BL/6J mice targeting the Liver and delivery is measured by luciferase expression. | ||
| Delivery System | 113-O12B | combinatorial library cationic lipid nanoparticles | Xu lab | |
| Experiment | Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. | C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification. | ||
| Vector | AAV9-GFP | AAV2/9 self complementary vector expressing GFP driven by CBh promoter | Asokan Lab | |
| Vector | AAV9-CMV-SaCas9 | AAV serotype 9 delivering CMV driven SaCas9 | Asokan Lab |
Show Experiments (3)
|
| Experiment | [Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. | Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues. | ||
| Project | Evolving High Potency AAV Vectors for Neuromuscular Genome Editing | Recombinant adeno-associated viruses (AAV) have emerged as safe and effective vectors for clinical gene therapy applications including systemic treatment of neuromuscular diseases such as Spinal Muscular Atrophy (SMA), Duchenne Muscular Dystrophy (DMD), and Giant Axonal Neuropathy (GAN) amongst others. However, genome editing in neuromuscular tissue, in particular, is challenging. The current proposal is on a comprehensive and innovative approach to evolve high potency AAV variants for systemic neuromuscular genome editing. |
Show Experiments (9)
|
|
| Guide | JCR183 | guide targeting an intronic seqeunce within the Rhesus and human DMD gene | AAV encoded (see vector details) | |
| Model System | B6 | C57BL/6J WT mouse | Baylor College of Medicine | |
| Vector | AAV4-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAV6-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Guide | R26-52 | IDT | ||
| Antibody | RRID:AB_141637 | |||
| Delivery System | AAV | See vector details |
Show Experiments (10)
|
|
| Model System | Ai14 mouse (congenic) | Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. | The Jackson Laboratory |
Show Experiments (7)
|
| Guide | STS204 (DNMT1; Sp_t2:Sp_c20_Dnmt1) | For endogenous locus | In house production | |
| Experiment | Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. | Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression. | ||
| Antibody | AB_2209751 | Anti-RFP (RABBIT) Antibody | ||
| Antibody | AB_141607 | Invitrogen, Donkey anti-mouse alexafluor 488 | ||
| Experiment | [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain | Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice | ||
| Genome Editor | CleanCap® Fluc | Firefly luciferase mRNA capped using CleanCap. It is polyadenylated, modified with 5-methoxyuridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. | Trilink Biotechnologies |
Show Experiments (1) |
| Experiment | On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver | On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10. |
Show Project |
|
| Vector | AAV-Pcsk9 | |||
| Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) | A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. | A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Experiment | Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) | A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Vector | AAV9-Ai9-sgRNA1-CB-SaCas9 | AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAVcc47_pTR_self comp 2xU6-Ai9 guides | AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene | Asokan Lab | |
| Experiment | [Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear | Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal. | ||
| Project | Delivery Technologies for In Vivo Genome Editing | The difficulty of delivering genome editing agents into many types of cells in animals and patients is a major challenge that must be overcome to realize their full potential to cure genetic diseases. We propose to develop two new strategies for the delivery of genome editing agents into animals and patients that will increase editing efficiency, target cell selectivity, and DNA specificity, as well as a new tool to rapidly and sensitively evaluate the delivery of these agents in mice with minimal effort and expense. These developments will advance the safety and efficacy of genome editing methods for clinical development. | ||
| Experiment | [Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver | Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced. | ||
| Vector | AAV3b-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Model System | TLR-2 mouse | R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways. | The Jackson Laboratory |
Show Experiments (1) |
| Vector | AAVrh8-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAVcc47-CMV-Cre | AAVcc47 delivering CMV Cre Recombinase | Asokan Lab |
Show Experiments (1) |
| Experiment | [Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear | Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed. | ||
| Delivery System | RNP-NC-CPP | The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity | Gong Lab |
Show Experiments (6)
|
| Project | The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) | The revolution in gene editing technology promises to transform the development of therapeutics to treat human disease. As part of the Somatic Cell Genome Editing consortium, the goal of this project is to build mouse resources and provide an animal model testing platform to support the optimization of novel genome editing technologies for future translational applications. |
Show Experiments (18)
|
|
| Vector | AAV9-mCherry | AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter | Asokan Lab | |
| Guide | Ai9 SaCas9 Guide A | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | Ai9 SaCas9 Guide B | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Genome Editor | SauCas9 | |||
| Vector | AAVcc47-SaCas9-Ai9 | AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter | Asokan Lab | |
| Vector | BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2 | Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds | Deverman Lab | |
| Vector | BI28:AAV-GFAP-SaCas9-WPRE3-pA | Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter | Deverman Lab | |
| Guide | STS159 (mTmG; Sp_t2:Sp_c20_mTmG) | This sgRNA targets the mTmG transgene | In house production |
Show Experiments (4)
|
| Model System | Ai14 mouse | Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. | The Jackson Laboratory | |
| Project | Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain | In vivo genome editing using CRISPR/Cas9 is anticipated to be the next wave of therapeutics for various major health threats, including neurodegenerative diseases. However, to date, very few Cas9-gRNA ribonucleoprotein in vivo delivery methods have been reported, and delivery to the brain has been particularly challenging. The unique nanocapsules we plan to develop will ultimately enable high efficiency neuron-targeted genome editing in the brain, thereby offering new hope to treat devastating neurodegenerative diseases. | ||
| Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) | A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Vector | AAV9-Ai9-sgRNA2-CB-SaCas9 | AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAV9_pTR_self comp 2xU6-Ai9 guides | AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene | Asokan Lab | |
| Genome Editor | SaCas9 | Asokan lab | ||
| Vector | AAV9-SaCas9/guide DMD | All-in-one vector casette (CMV-saCas9-U6-gRNA [human/rhesus DMD intron]) | Asokan/Gersbach Labs | |
| Vector | AAVcc47-SaCas9/guide DMD | All-in-one vector casette (CMV-saCas9-U6-gRNA [human/rhesus DMD intron]) | Asokan/Gersbach Labs | |
| Experiment | [Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear | Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice | ||
| Antibody | RRID:AB_2536526 | GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362 |
Show Experiments (3)
|
|
| Antibody | RRID:AB_2313606 | Vector Labs Goat Anti-Rabbit IgG Biotinylated Cat. #BA-1000 | ||
| Guide | Pcsk9 Exon 1 splice domain | Pcsk9 Exon 1 splice domain | Synthego | |
| Experiment | AAV Tropism project | Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging | ||
| Project | SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice |
Show Experiments (1) |
||
| Guide | L2-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | Ai14 gRNA | This sgRNA targets the Ai9 and related transgenes at multiple sites | IDT |
Show Experiments (3)
|
| Antibody | RRID:AB_2532994 | |||
| Antibody | RRID:AB_2813835 | |||
| Guide | sg298 | This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases | Synthego |
Show Experiments (4)
|
| Delivery System | RNP-NC-no ligand | The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. | Gong Lab |
Show Experiments (4)
|
| Delivery System | 306-O12B | Combinatorial library cationic lipid nanoparticles | Xu lab |
Show Experiments (7)
|
| Project | Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles | The proposal is designed to screen lipid nanoparticles as novel materials for RNP (ribonucleoprotein) delivery of editing machinery into the mammalian sensory organ inner ear, to expand the cell types that can be edited to treat genetic hearing loss and to establish a method to perform the study in wildtype large animals. This study has direct relevance to bringing editing based therapy to clinic. |
Show Experiments (3)
|
|
| Model System | C57BL/6 mouse (Asokan study) | Unspecified | ||
| Experiment | Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. | C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification. | ||
| Vector | AAVcc47-mCherry | AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter | Asokan Lab | |
| Vector | AAVcc81-GFP | AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter | Asokan Lab | |
| Guide | L1-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded |
Show Experiments (3) |
| Experiment | [Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain | Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice | ||
| Antibody | AB_10015251 | Anti-Myosin VIIa antibody, Proteus Biosciences | ||
| Antibody | AB_2286684 | Sox-2 (Y-17) Antibody, Santa Cruz Biotechnology | ||
| Project | Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System | This project aims to advance the NIH Somatic Cell Genome Editing Program’s objective to identify novel delivery technologies that enable genome editing in therapeutically relevant somatic cell populations. We will use proven virus engineering methods to develop new vehicles that can deliver genome editing machinery throughout the adult mammalian central nervous system. Accomplishing this objective would pave the road for applying gene editing, and gene therapy more broadly, to the study and treatment of neurological and psychiatric disorders. | ||
| Guide | R2-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Experiment | Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center | Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain | ||
| Project | Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors | RNA-guided CRISPR genome editing systems promise to revolutionize the treatment of inherited disease. Safe, effective, and target-tissue-specific delivery of the guide RNA that directs editing is a critical hurdle in the development of clinical applications for engineered CRISPR systems. Using strategies validated for the delivery of other categories of nucleic acid therapeutics, we have established a framework for complete chemical modification of CRISPR guides, thereby conferring in vivo stability and effective biodistribution properties. The proposed research will optimize these guides, as well as other editing components, for clinical use. |
Show Experiments (11)
|
|
| Genome Editor | SpyCas9-3xNLS | SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal | Sontheimer lab |
Show Experiments (7)
|
| Antibody | AB_2532994 | Thermo-Fisher, Rat anti-GFAP | ||
| Antibody | AB_10711040 | Abcam, mouse anti-NeuN | ||
| Antibody | AB_141637 | Invitrogen, Donkey anti-rabbit alexa fluor 594 | ||
| Antibody | AB_2813835 | Abcam, Donkey anti-rat alexa fluour 647 | ||
| Experiment | Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea | Delivery of Cas9/sgRNA mRNA via new LNPs to the cochlea by cochleostomy and gene editing is measured by percentage of tdTomato positive cells. | ||
| Delivery System | 306-O12B blank | Combinatorial library cationic lipid nanoparticles | Xu lab | |
| Experiment | [Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear | Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice | ||
| Experiment | Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. | 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later. | ||
| Genome Editor | SaCas9 |
Show Experiments (3) |
||
| Antibody | RRID:AB_1196615 | GFP (D5.1) XP Rabbit mAb antibody, Cell Signaling Technology |
Show Experiments (3)
|
|
| Experiment | [Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain | Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections. | ||
| Genome Editor | CleanCap® Cas9 | SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. | Trilink Biotechnologies |