186 results for Epithelium

Cas9 ribonucleoprotein delivery targeted to kidney epithelium

Project  - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects]
Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium name : Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Wilson Ross , Freedman Benjamin S  Last Updated Date: 2024-01-16
 

Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: description : Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
McCray Paul  Last Updated Date: 2020-11-02 NIH Report
 
Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells.

sg298

Guide  - [In Vivo, In Vitro] [Mouse]
Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium termSynonyms : Ecto-epithelium Epithelium
This sgRNA targets the Ai9 and related transgenes at multiple sites

Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides

Project  - [In Vivo, In Vitro] [Delivery Systems]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
McCray Paul  Last Updated Date: 2020-11-02 NIH Report
 
The proposed research is relevant to the public health because genetic and acquired diseases affecting the airways pose major disease and economic burdens. By advancing the delivery of gene editing tools, it may be possible to therapeutically modify the cells lining the airways. This novel strategy has implications for the treatment of both monogenetic and acquired lungs disease, and may have applications for other somatic cell therapies.

Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases

Project  - [In Vivo, In Vitro] [Delivery Systems]
Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Gao Guang-Ping  Last Updated Date: 2021-09-21 NIH Report
 
Efficacy and safety limitations in current gene editing technologies have hindered efforts to treat genetic lung diseases. This proposal seeks to develop and validate a combinatorial delivery approach that uses non-viral and viral vehicles to efficiently transport gene editing tools to disease-relevant cells in the lung. Completion of our work will establish safe and effective delivery vehicles that will guide the design of future gene therapies for genetic disorders.

BALB/c mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO).

mTmG mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence

Antibody  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Other Id:
Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000

Antibody  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Other Id:
Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200

[Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
Heaney Jason  Last Updated Date: 2021-09-07 NIH Report
 
Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings

D10

Delivery System  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium

[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
Heaney Jason  Last Updated Date: 2021-03-30 NIH Report
 
AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway

scAAV5-Cre-GFP

Vector  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium

ssAAV5-spCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium

RRID:AB_2043201 

Antibody  - [In Vitro]
Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Other Id: Abcam (ab89901)
anti-Wilms Tumor-1 (WT1)

BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice

Project  - [In Vivo] [Animal Reporter and Testing Center]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Ecto-epithelium Meso-epithelium Lung epithelium Epithelium Endo-epithelium
Heaney Jason  Last Updated Date: 2023-12-18 NIH Report
 
Genome editing systems have the potential to cure some of the most severe human diseases. However, there are significant efficacy and safety issues that must be addressed before this technology can be applied in clinical trials. The BCM-Rice Resource Center for the Analysis of Somatic Gene Editing in Mice will create mouse reporter models for testing genome editing technologies, and to use these animal models to test genome editing delivery technologies and new genome editors developed by other Somatic Cell Genome Editing program members.

Podocyte-specific gene editing in human kidney organoids

Experiment  - [In Vitro] [Delivery Systems, Collaborative Opportunity Fund, Biological Effects]
Matched Fields: study : Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Wilson Ross , Freedman Benjamin S  Last Updated Date: 2024-01-16
 
Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter.

ABE8e-Cas9

Genome Editor  - [In Vivo, In Vitro] [Human, Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium
A-to-G base editor

Base Editing in Rhesus Airway Epithelial

Project  - [In Vivo, In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium
Liu David , McCray Paul , Tarantal Alice , Guay David  Last Updated Date: 2023-03-15
 

RRID:AB_2565050 

Antibody  - [In Vivo] [Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium
Other Id: 07-623 T6793 PA5-71680 905501.0
rabbit polyclonal antibody to detect cytokeratin5+ basal cells, uncojugated, 905501, Biolegend

gRNA #8

Guide  - [In Vivo, In Vitro] [Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium

Antibody  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Other Id:
Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300

RRID:AB_477585 

Antibody  - [In Vivo] [Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium
Other Id: 07-623 T6793 PA5-71680 905501.0
mouse monocolonal antibody against the acetylated α-tubulin, unconjugated, T6793, Sigma-Aldrich

SaCas9

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium

SpCas9

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium

mTmG mouse (congenic)

Model System  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Ecto-epithelium Columnar epithelium Lung epithelium Epithelium
mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed.
Show Experiments (7)

On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium
Chaikof Elliot  Last Updated Date: 2022-04-15 NIH Report
 
On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10.

AAV9_pTR_self comp 2xU6-Ai9 guides

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene

AAVcc47-Ai9-sgRNA1-CB-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus

AAVcc47-Ai9-sgRNA2-CB-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus

Ai9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchus termSynonyms : Ecto-epithelium Ciliated epithelium Meso-epithelium Epithelium Endo-epithelium
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.
Show Experiments (11)

AAVcc47-SaCas9/guide DMD

Vector  - [In Vivo]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
All-in-one vector casette (CMV-saCas9-U6-gRNA [human/rhesus DMD intron])

B6

Model System  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
C57BL/6J WT mouse

RRID:AB_10563941 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Other Id: Invitrogen, R10367
Polyclonal rabbit anti-RFP antibody

AAV4-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAV6-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

sg298

Guide  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases

RNP-NC-CPP

Delivery System  - [In Vivo, In Vitro] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity

RNP-NC-RVG

Delivery System  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry

306-O12B

Delivery System  - [In Vivo, In Vitro] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Combinatorial library cationic lipid nanoparticles

The Jackson Laboratory Gene Editing Testing Center (JAX-GETC)

Project  - [In Vivo, In Vitro] [Animal Reporter and Testing Center]
Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium
Murray Stephen  Last Updated Date: 2024-08-30 NIH Report
 
The revolution in gene editing technology promises to transform the development of therapeutics to treat human disease. As part of the Somatic Cell Genome Editing consortium, the goal of this project is to build mouse resources and provide an animal model testing platform to support the optimization of novel genome editing technologies for future translational applications.
Show Experiments (18)

Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles

Project  - [In Vivo, In Vitro] [Delivery Systems]
Matched Fields: termSynonyms : Ecto-epithelium Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium
Chen Zheng-Yi  Last Updated Date: 2021-04-13 NIH Report
 
The proposal is designed to screen lipid nanoparticles as novel materials for RNP (ribonucleoprotein) delivery of editing machinery into the mammalian sensory organ inner ear, to expand the cell types that can be edited to treat genetic hearing loss and to establish a method to perform the study in wildtype large animals. This study has direct relevance to bringing editing based therapy to clinic.

Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2020-11-19 NIH Report
 
C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.

Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2020-11-19 NIH Report
 
C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.

AAVcc47-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/5 expressing Cre recombinase

Antibody  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Other Id:
Anti-RFP (RABBIT) Antibody

Testing AAV5 for activation of tdTomato in mouse airway

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Gao Guang-Ping  Last Updated Date: 2020-10-20 NIH Report
 
AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation

Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
McCray Paul  Last Updated Date: 2020-11-02 NIH Report
 
In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells.

RRID:AB_2313606 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: Thermo Fisher Scientific Cat# G10362 Vector Labs Cat# BA-1000
Vector Labs Goat Anti-Rabbit IgG Biotinylated Cat. #BA-1000

SpyCas9-3xNLS

Genome Editor  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal

sgAi9L

Guide  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
This sgRNA targets the Ai9 and related transgenes

AAV.pU1a-SpCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS

AB_2532994 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: Ab104224  Rockland Cat# 600-401-379 A21202 A21207 Ab150155 13-0300 
Thermo-Fisher, Rat anti-GFAP

Macaca mulatta (Rhesus Macaque)

Model System  - [In Vivo] [Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium

Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway

Experiment  - [In Vivo] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium
Liu David , McCray Paul , Tarantal Alice , Guay David  Last Updated Date: 2023-03-15
 
We utilized novel amphiphilic shuttle peptides to deliver base editor ribonucleoprotein (RNP) into the airways to edit airway epithelial cells (CCR5 locus) of rhesus monkeys. The Cas9-ABE8e RNP and shuttle peptides S10 or FSD315 were aerosolized into the rhesus monkey trachea. Seven days later, tissues were obtained and dissected, and airway epithelia collected from the trachea, mainstem, and segmental bronchi using cytology brushes. DNA was extracted from epithelial cells and subjected to high-throughput sequencing. Using the FSD315 shuttle peptide and Cas9-ABE8e, we achieved a mean editing efficiency of 2.8% at the CCR5 locus in airway epithelial cells (range 0.02 – 5.3%) depending on the anatomic region sampled. To visualize the biodistribution of the RNPs within the respiratory tract and in specific cell types, we delivered a Cy5-fluorescent peptide fused to a nuclear localization signal (NLS-Cy5) using the S10 peptide. The lungs were obtained 1 and 2 hours post-delivery, fixed, and examined by microscopy. Epifluorescence and confocal microscopy documented an effective intra-nuclear delivery of NLS-Cy5 into epithelial cells throughout the respiratory tract, including large, medium, and small airways, and alveolar regions. Ongoing analyses will identify the NLS-Cy5-positive epithelial cell types using co-localization with fluorescently-labeled antibodies. In summary, using a rhesus monkey model, following a single delivery of adenine base editor RNPs to the airways in a clinically relevant manner we achieved up to 5.3% editing efficiency of the CCR5 locus in airway epithelia, a level considered therapeutically relevant in cystic fibrosis.

BCM_ssAAV5-Sp_sgA

Guide  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
This sgRNA targets the Ai9 and related transgenes

ssAAV5-sgA+sgB-U1A.GFP

Vector  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium

[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Heaney Jason  Last Updated Date: 2023-05-10 NIH Report
 
Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

SaCas9

Genome Editor  - [In Vivo]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium

Pcsk9 adenine base editor efficiency in liver and nonliver tissue

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
Chaikof Elliot  Last Updated Date: 2022-04-15 NIH Report
 
Adenine base editing at the Pcsk9 exon 1 splice donor site in mouse heart, kidney, liver, lungs, muscle, and spleen was assessed one week after systemic administration of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs) in C56BL/6 mice

TadA-8e V106W

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W)

R26-52

Guide  - [In Vivo, In Vitro] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium

RRID:AB_141637 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium

AAV9-mCherry

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter

Ai9 SaCas9 Guide B

Guide  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium
This gRNA targets the Ai9 and related transgenes

Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Sontheimer Erik  Last Updated Date: 2021-10-01 NIH Report
 
Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain

[Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Murray Stephen  Last Updated Date: 2023-05-10 NIH Report
 
Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections.

AB_2209751 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: Ab104224  Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 
Anti-RFP (RABBIT) Antibody

AB_10711040 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: Ab104224  Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 
Abcam, mouse anti-NeuN

AB_2813835 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: Ab104224  Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 
Abcam, Donkey anti-rat alexa fluour 647

[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Murray Stephen  Last Updated Date: 2023-05-10 NIH Report
 
Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice

L2-modified

Guide  - [In Vivo, In Vitro] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
This gRNA targets the Ai9 and related transgenes

Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System

Project  - [In Vivo, In Vitro] [Delivery Systems]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Deverman Ben  Last Updated Date: 2021-04-17 NIH Report
 
This project aims to advance the NIH Somatic Cell Genome Editing Program’s objective to identify novel delivery technologies that enable genome editing in therapeutically relevant somatic cell populations. We will use proven virus engineering methods to develop new vehicles that can deliver genome editing machinery throughout the adult mammalian central nervous system. Accomplishing this objective would pave the road for applying gene editing, and gene therapy more broadly, to the study and treatment of neurological and psychiatric disorders.

BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds

AB_10015251 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: 25-6790 Sc-17320
Anti-Myosin VIIa antibody, Proteus Biosciences

AB_2286684 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: 25-6790 Sc-17320
Sox-2 (Y-17) Antibody, Santa Cruz Biotechnology

CleanCap® Cas9

Genome Editor  - [In Vivo, In Vitro] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA.

Antibody  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Other Id:
GFP (D5.1) XP Rabbit mAb antibody

g-loxP2_C9

Guide  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
This sgRNA targets the Ai9 and related transgenes

g-loxPbot_C12a

Guide  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
This sgRNA targets the Ai9 and related transgenes at two sites

H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)

Vector  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP

S10

Delivery System  - [In Vivo, In Vitro] [Human, Mouse, Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium Lung epithelium
Shuttle peptide used to deliver reagents to airway epithelia
Show Experiments (12)

RRID:AB_310759 

Antibody  - [In Vivo] [Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium
Other Id: 07-623 T6793 PA5-71680 905501.0
rabbit polyclonal antibody against club cell secretory protein, unconjugated, 07-623, EMD

RRID:AB_2717534 

Antibody  - [In Vivo] [Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium
Other Id: 07-623 T6793 PA5-71680 905501.0
rabbit polyclonal antibody against the pulmonary-associated surfactant protein C (SPC), unconjugated, PA5-71680, Invitrogen

Ai9-SauSpyCas9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.

Ai9 mouse (BCM)

Model System  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.

D237

Delivery System  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium

BCM_ssAAV5-Sp_sgB

Guide  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
This sgRNA targets the Ai9 and related transgenes

ssAAV5-sgB.saCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium

CleanCap® Fluc

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium
Firefly luciferase mRNA capped using CleanCap. It is polyadenylated, modified with 5-methoxyuridine and optimized for mammalian systems. It mimics a fully processed mature mRNA.

AAV-Pcsk9

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

AAV9-Ai9-sgRNA2-CB-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus

AAVcc47_pTR_self comp 2xU6-Ai9 guides

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene

Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intramuscular administration to rhesus macaques

Experiment  - [In Vivo] [Delivery Systems]
Matched Fields: termSynonyms : Ecto-epithelium Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium
Asokan Aravind  Last Updated Date: 2025-10-29 NIH Report
 
Phase II, AAV9 (n=4) and AAVcc47 (n=4) were administered via intramuscular injection in rhesus macaques and organs were harvested 4 weeks post injection.

JCR183

Guide  - [In Vivo]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
guide targeting an intronic seqeunce within the Rhesus and human DMD gene

Delivery Technologies for In Vivo Genome Editing

Project  - [In Vivo] [Delivery Systems]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
Chaikof Elliot  Last Updated Date: 2022-04-15 NIH Report
 
The difficulty of delivering genome editing agents into many types of cells in animals and patients is a major challenge that must be overcome to realize their full potential to cure genetic diseases. We propose to develop two new strategies for the delivery of genome editing agents into animals and patients that will increase editing efficiency, target cell selectivity, and DNA specificity, as well as a new tool to rapidly and sensitively evaluate the delivery of these agents in mice with minimal effort and expense. These developments will advance the safety and efficacy of genome editing methods for clinical development.

Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intravenous administration to rhesus macaques

Experiment  - [In Vivo] [Delivery Systems]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2025-10-29 NIH Report
 
Phase I, AAV9 (n=4) and AAVcc47 (n=4) were administered via intravenous injection in rhesus macaques and organs were harvested 4 weeks post injection.

Pcsk9 Exon 1 splice domain

Guide  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
Pcsk9 Exon 1 splice domain

AAV Tropism project

Experiment  - [In Vivo] [AAV tropism] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Murray Stephen , Gao Guang-Ping , Lagor William , Heaney Jason , Lutz Cathleen , Dickinson Mary E  Last Updated Date: 2023-02-10
 
Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging

SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice

Project  - [In Vivo] [AAV tropism]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Murray Stephen , Gao Guang-Ping , Lagor William , Heaney Jason , Lutz Cathleen , Dickinson Mary E  Last Updated Date: 2023-02-10
 
Show Experiments (1)

AAV7-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

TLR-2 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways.

AAVrh74-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Murray Stephen  Last Updated Date: 2023-07-18 NIH Report
 
Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed.

RRID:AB_2209751 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium

C57BL/6 mouse (Asokan study)

Model System  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium

AAVcc47-mCherry

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter

AAVcc84-GFP

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter

Evolving High Potency AAV Vectors for Neuromuscular Genome Editing

Project  - [In Vivo] [Delivery Systems]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2025-10-29 NIH Report
 
Recombinant adeno-associated viruses (AAV) have emerged as safe and effective vectors for clinical gene therapy applications including systemic treatment of neuromuscular diseases such as Spinal Muscular Atrophy (SMA), Duchenne Muscular Dystrophy (DMD), and Giant Axonal Neuropathy (GAN) amongst others. However, genome editing in neuromuscular tissue, in particular, is challenging. The current proposal is on a comprehensive and innovative approach to evolve high potency AAV variants for systemic neuromuscular genome editing.
Show Experiments (9)

AsCas12a (IDT and Feldan Therapeutics)

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium

GFP-NLS

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
Nuclear targeted GFP

SpCas9

Genome Editor  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
HA-SV40NLS-SpCas9-SV40NLS

sgAi9R

Guide  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus Epithelium of main bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
This sgRNA targets the Ai9 and related transgenes

Antibody  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Other Id:
Anti-RFP (Rabbit) Polyclonal Antibody

Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: tissueTerm : Epithelium of bronchus termSynonyms : Columnar epithelium Epithelium Foregut epithelium Ciliated epithelium Endo-epithelium
Gao Guang-Ping  Last Updated Date: 2021-09-21 NIH Report
 
AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.

FSD315

Delivery System  - [In Vivo, In Vitro] [Human, Mouse, Rhesus macaque]
Matched Fields: tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium
Shuttle peptide used to deliver reagents to airway epithelia
Show Experiments (7)

Alt-R™ S.p. Cas9 Nuclease V3

Genome Editor  - [In Vivo, In Vitro] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Ecto-epithelium Columnar epithelium Lung epithelium Epithelium
Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol.
Show Experiments (10)

BCM_ssAAV5-Sa_sgB

Guide  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
This gRNA targets the Ai9 and related transgenes

SpyCas9 g-loxP2_C9

Guide  - [In Vivo] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
This sgRNA targets the mTmG transgene

Cre recombinase

Genome Editor  - [In Vivo, In Vitro] [Mouse]
Matched Fields: tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Ecto-epithelium Meso-epithelium Lung epithelium Epithelium Endo-epithelium
Cre recombinase delivered by AAV (see vector details)

Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Unilaminar epithelium Endo-epithelium
Chen Zheng-Yi  Last Updated Date: 2021-04-13 NIH Report
 
Delivery of firefly luciferase mRNA via new Lipid NanoParticles by tail vein injection into WT C57BL/6J mice targeting the Liver and delivery is measured by luciferase expression.

Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.

AAV9-Ai9-sgRNA1-CB-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus

AAV9-Ai9-sgRNA1 + sgRNA2

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus

AAVcc47-Ai9-sgRNA1 + sgRNA2

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus

AAV9-SaCas9/guide DMD

Vector  - [In Vivo]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
All-in-one vector casette (CMV-saCas9-U6-gRNA [human/rhesus DMD intron])

ABE8e

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
Catalytically impaired Cas fused to TadA deaminase

[Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
Heaney Jason  Last Updated Date: 2023-12-18 NIH Report
 
Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced.

AAV3b-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAV5-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAV8-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Murray Stephen  Last Updated Date: 2024-08-30 NIH Report
 
Heterozygous embryos containing the traffic light reporter 2 (TLR-2) reporter at the Rosa26 locus were evaluated for activation potential following electroporation of two guide/RNP combinations and transfer to pseudo-pregnant hosts for development to term. Offspring (founders) with activating edits were mated to wild-type females and adult tissues from progeny were assessed for tagRFP fluorescence.

AAVrh10-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

CleanCap® Cas9 mRNA (5moU)

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA.

RRID:AB_2532994 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium

[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Murray Stephen  Last Updated Date: 2023-07-11 NIH Report
 
Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed.

RRID:AB_2813835 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium

113-O12B

Delivery System  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium
combinatorial library cationic lipid nanoparticles

AAVcc81-GFP

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter

SauCas9

Genome Editor  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium

AAVcc47-SaCas9-Ai9

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter

[Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Murray Stephen  Last Updated Date: 2023-05-10 NIH Report
 
Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice

306-O12B blank

Delivery System  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Combinatorial library cationic lipid nanoparticles

[Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Murray Stephen  Last Updated Date: 2023-05-10 NIH Report
 
Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice

AAVcc47-CMV-SaCas9

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Digestive tract epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAVcc47 delivering CMV driven SaCas9

AAV9-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

AAVrh8-ZsGreen-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV backbone with a bi-directional promoter driving zsGreen and Cre
Show Experiments (1)

Cre Recombinase dose escalation study in Ai9 mice

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
Asokan Aravind  Last Updated Date: 2021-09-16 NIH Report
 
A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images.

AAV9-CMV-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV serotype 9 delivering CMV Cre Recombinase

AAVcc47-CMV-Cre

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAVcc47 delivering CMV Cre Recombinase

Ai14 gRNA

Guide  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
This sgRNA targets the Ai9 and related transgenes at multiple sites

RRID:AB_10711040 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium

sNLS-SpCas9-sNLS

Genome Editor  - [In Vivo, In Vitro] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
SpCas9 with N- and C-terminal SV40 NLS

RRID:AB_141607 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium

RNP-NC-no ligand

Delivery System  - [In Vivo, In Vitro] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA.

AAV

Delivery System  - [In Vivo, In Vitro] [Human, Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
See vector details
Show Experiments (10)

AAV9-GFP

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
AAV2/9 self complementary vector expressing GFP driven by CBh promoter

Ai14 mouse (congenic)

Model System  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium
Heaney Jason  Last Updated Date: 2021-03-30 NIH Report
 
Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.

Ai9 SaCas9 Guide A

Guide  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Columnar epithelium Foregut epithelium Epithelium Endo-epithelium Meso-epithelium
This gRNA targets the Ai9 and related transgenes

Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Gong Sarah  Last Updated Date: 2020-10-28 NIH Report
 
Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression.

Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain

Project  - [In Vivo] [Delivery Systems]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Gong Sarah  Last Updated Date: 2020-10-28 NIH Report
 
In vivo genome editing using CRISPR/Cas9 is anticipated to be the next wave of therapeutics for various major health threats, including neurodegenerative diseases. However, to date, very few Cas9-gRNA ribonucleoprotein in vivo delivery methods have been reported, and delivery to the brain has been particularly challenging. The unique nanocapsules we plan to develop will ultimately enable high efficiency neuron-targeted genome editing in the brain, thereby offering new hope to treat devastating neurodegenerative diseases.

AB_141637 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: Ab104224  Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 
Invitrogen, Donkey anti-rabbit alexa fluor 594

AB_141607 

Antibody  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Other Id: Ab104224  Rockland Cat# 600-401-379 A21202 Ab150155 A21207 13-0300 
Invitrogen, Donkey anti-mouse alexafluor 488

[Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear

Experiment  - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Murray Stephen  Last Updated Date: 2023-07-11 NIH Report
 
Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal.

Testing gRNA sequence and gRNA scaffold modified in Ai9 mice.

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Deverman Ben  Last Updated Date: 2021-04-17 NIH Report
 
3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later.

R2-modified

Guide  - [In Vivo, In Vitro] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
This gRNA targets the Ai9 and related transgenes

BI28:AAV-GFAP-SaCas9-WPRE3-pA

Vector  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter

Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors

Project  - [In Vivo, In Vitro] [Delivery Systems]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Sontheimer Erik  Last Updated Date: 2021-10-01 NIH Report
 
RNA-guided CRISPR genome editing systems promise to revolutionize the treatment of inherited disease. Safe, effective, and target-tissue-specific delivery of the guide RNA that directs editing is a critical hurdle in the development of clinical applications for engineered CRISPR systems. Using strategies validated for the delivery of other categories of nucleic acid therapeutics, we have established a framework for complete chemical modification of CRISPR guides, thereby conferring in vivo stability and effective biodistribution properties. The proposed research will optimize these guides, as well as other editing components, for clinical use.
Show Experiments (11)

Ai14 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea

Experiment  - [In Vivo] [Delivery Systems] [Mouse]
Matched Fields: termSynonyms : Ecto-epithelium Epithelium
Chen Zheng-Yi  Last Updated Date: 2021-04-13 NIH Report
 
Delivery of Cas9/sgRNA mRNA via new LNPs to the cochlea by cochleostomy and gene editing is measured by percentage of tdTomato positive cells.

186 results for Epithelium

Category Name Description Source View Associated...
Project Cas9 ribonucleoprotein delivery targeted to kidney epithelium
Experiment Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia. Delivery of GFP via shuttle peptides to mouse airway epithelium via nasal instilation. Delivery efficiency was quantified in large and small airways by counting the number of GFP positive cells divided by the number of DAPI cells.
Guide sg298 This sgRNA targets the Ai9 and related transgenes at multiple sites Synthego
Project Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides The proposed research is relevant to the public health because genetic and acquired diseases affecting the airways pose major disease and economic burdens. By advancing the delivery of gene editing tools, it may be possible to therapeutically modify the cells lining the airways. This novel strategy has implications for the treatment of both monogenetic and acquired lungs disease, and may have applications for other somatic cell therapies.
Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases Efficacy and safety limitations in current gene editing technologies have hindered efforts to treat genetic lung diseases. This proposal seeks to develop and validate a combinatorial delivery approach that uses non-viral and viral vehicles to efficiently transport gene editing tools to disease-relevant cells in the lung. Completion of our work will establish safe and effective delivery vehicles that will guide the design of future gene therapies for genetic disorders.
Model System BALB/c mouse BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). The Jackson Laboratory
Model System mTmG mouse ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence The Jackson Laboratory
Antibody Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000
Antibody Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200
Experiment [Validation] Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Ribonucleoproteins for CRISPR/Cas9 editing are complexed with amphiphilic peptides for delivery to lung airway epithilia via intranasal instillation into mTmG reporter mice. Editing is detected by production of GFP protein, and green fluorescence in airway linings
Delivery System D10 McCray Lab
Experiment [Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway
Vector scAAV5-Cre-GFP Gao Lab
Vector ssAAV5-spCas9 Gao Lab
Antibody RRID:AB_2043201  anti-Wilms Tumor-1 (WT1)
Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice Genome editing systems have the potential to cure some of the most severe human diseases. However, there are significant efficacy and safety issues that must be addressed before this technology can be applied in clinical trials. The BCM-Rice Resource Center for the Analysis of Somatic Gene Editing in Mice will create mouse reporter models for testing genome editing technologies, and to use these animal models to test genome editing delivery technologies and new genome editors developed by other Somatic Cell Genome Editing program members.
Experiment Podocyte-specific gene editing in human kidney organoids Kidney organoids were derived from a human iPS cell line with Ai9 (tdTomato) fluorescence-on reporter knocked into the AAVS1 safe harbor locus. Intact kidney organoids were transfected with CRISPR ribonucleoprotein complexes with and without molecular targeting agent (MTA) specific for podocytes. Genome editing events were detected by induction of tdTomato from the Ai9 reporter.
Genome Editor ABE8e-Cas9 A-to-G base editor Feldan Therapeutics
Project Base Editing in Rhesus Airway Epithelial
Antibody RRID:AB_2565050  rabbit polyclonal antibody to detect cytokeratin5+ basal cells, uncojugated, 905501, Biolegend
Guide gRNA #8 IDT
Antibody Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300
Antibody RRID:AB_477585  mouse monocolonal antibody against the acetylated α-tubulin, unconjugated, T6793, Sigma-Aldrich
Genome Editor SaCas9 Vector Encoded (ssaav5-sga+sgb-u1a.gfp)
Genome Editor SpCas9 IDT
Model System mTmG mouse (congenic) mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. The Jackson Laboratory
Show Experiments (7)
Experiment On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10.
Genome Editor SaCas9-Lagor William Lagor, Baylor College Of Medicine
Vector AAV9_pTR_self comp 2xU6-Ai9 guides AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Asokan Lab
Vector AAVcc47-Ai9-sgRNA1-CB-SaCas9 AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Vector AAVcc47-Ai9-sgRNA2-CB-SaCas9 AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Model System Ai9 mouse Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The Jackson Laboratory
Show Experiments (11)
Vector AAVcc47-SaCas9/guide DMD All-in-one vector casette (CMV-saCas9-U6-gRNA [human/rhesus DMD intron]) Asokan/Gersbach Labs
Model System B6 C57BL/6J WT mouse Baylor College of Medicine
Antibody RRID:AB_10563941  Polyclonal rabbit anti-RFP antibody
Vector AAV4-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAV6-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Guide sg298 This sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases Synthego
Delivery System RNP-NC-CPP The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a cell penetrating peptide (CPP) from the TAT peptide (GRKKRRQRRRPQ) which lacks cell-type specficity Gong Lab
Delivery System RNP-NC-RVG The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. This nanoparticle has an addition of a RVG peptide YTIWMPENPRPGTPCDIFTNSRGKRASNG which specifically interacts withthe N-acetylecholine receptor (AchR) on neuronal cells, which mediates NP entry Gong Lab
Delivery System 306-O12B Combinatorial library cationic lipid nanoparticles Xu lab
Project The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) The revolution in gene editing technology promises to transform the development of therapeutics to treat human disease. As part of the Somatic Cell Genome Editing consortium, the goal of this project is to build mouse resources and provide an animal model testing platform to support the optimization of novel genome editing technologies for future translational applications.
Show Experiments (18)
Project Efficient In Vivo RNP-Based Gene Editing in the Sensory Organ Inner Ear Using Bioreducible Lipid Nanoparticles The proposal is designed to screen lipid nanoparticles as novel materials for RNP (ribonucleoprotein) delivery of editing machinery into the mammalian sensory organ inner ear, to expand the cell types that can be edited to treat genetic hearing loss and to establish a method to perform the study in wildtype large animals. This study has direct relevance to bringing editing based therapy to clinic.
Experiment Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.
Experiment Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.
Vector AAVcc47-Cre AAV2/5 expressing Cre recombinase Asokan Lab
Antibody Anti-RFP (RABBIT) Antibody
Experiment Testing AAV5 for activation of tdTomato in mouse airway AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation
Experiment Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia In vivo shuttle peptide delivery of Cas9 and Cas12a RNPs in mouse airway epithelia. Gene editing was quantified by the GFP+ cells in large and small airways following 1 delivery of GFP protein by GFP positive cells compared to DAPI stained cells.
Antibody RRID:AB_2313606  Vector Labs Goat Anti-Rabbit IgG Biotinylated Cat. #BA-1000
Genome Editor SpyCas9-3xNLS SpyCas9-3xNLS is type II-A Cas9 from Streptococcus pyogenes strain SF370. It was expressed from pMCSG7 bacterial expressing vector and purified from Escherichia coli Rosetta DE3 strain. SpyCas9 fused to 3 NLS: C-Myc-like NLS at the N-terminal SV40 NLS and Nucleoplasmin NLS at the C-terminal Sontheimer lab
Guide sgAi9L This sgRNA targets the Ai9 and related transgenes IDT
Vector AAV.pU1a-SpCas9 Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS Addgene
Antibody AB_2532994  Thermo-Fisher, Rat anti-GFAP
Model System Macaca mulatta (Rhesus Macaque) Tarantal Lab
Experiment Amphiphilic Peptides Deliver Base Editor RNPs to Rhesus Monkey Airway We utilized novel amphiphilic shuttle peptides to deliver base editor ribonucleoprotein (RNP) into the airways to edit airway epithelial cells (CCR5 locus) of rhesus monkeys. The Cas9-ABE8e RNP and shuttle peptides S10 or FSD315 were aerosolized into the rhesus monkey trachea. Seven days later, tissues were obtained and dissected, and airway epithelia collected from the trachea, mainstem, and segmental bronchi using cytology brushes. DNA was extracted from epithelial cells and subjected to high-throughput sequencing. Using the FSD315 shuttle peptide and Cas9-ABE8e, we achieved a mean editing efficiency of 2.8% at the CCR5 locus in airway epithelial cells (range 0.02 – 5.3%) depending on the anatomic region sampled. To visualize the biodistribution of the RNPs within the respiratory tract and in specific cell types, we delivered a Cy5-fluorescent peptide fused to a nuclear localization signal (NLS-Cy5) using the S10 peptide. The lungs were obtained 1 and 2 hours post-delivery, fixed, and examined by microscopy. Epifluorescence and confocal microscopy documented an effective intra-nuclear delivery of NLS-Cy5 into epithelial cells throughout the respiratory tract, including large, medium, and small airways, and alveolar regions. Ongoing analyses will identify the NLS-Cy5-positive epithelial cell types using co-localization with fluorescently-labeled antibodies. In summary, using a rhesus monkey model, following a single delivery of adenine base editor RNPs to the airways in a clinically relevant manner we achieved up to 5.3% editing efficiency of the CCR5 locus in airway epithelia, a level considered therapeutically relevant in cystic fibrosis.
Guide BCM_ssAAV5-Sp_sgA This sgRNA targets the Ai9 and related transgenes Vector encoded
Vector ssAAV5-sgA+sgB-U1A.GFP Gao Lab
Experiment [Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Genome Editor SaCas9 Asokan lab
Experiment Pcsk9 adenine base editor efficiency in liver and nonliver tissue Adenine base editing at the Pcsk9 exon 1 splice donor site in mouse heart, kidney, liver, lungs, muscle, and spleen was assessed one week after systemic administration of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs) in C56BL/6 mice
Genome Editor TadA-8e V106W Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W) Chaikof Lab
Guide L1-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Guide R26-52 IDT
Antibody RRID:AB_141637 
Vector AAV9-mCherry AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter Asokan Lab
Guide Ai9 SaCas9 Guide B This gRNA targets the Ai9 and related transgenes Vector encoded
Experiment Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain
Antibody RRID:AB_2536526  GFP Recombinant Rabbit Monoclonal Antibody, Thermo Fisher Scientific #G10362
Experiment [Validation] Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain Heavily modified guide RNAs complexed with Cas9 proteins are injected locally to mouse striatum to activate reporter gene (mGFP). Editing detected via DAB staining in coronal brain sections.
Guide STS204 (DNMT1; Sp_t2:Sp_c20_Dnmt1) For endogenous locus In house production
Antibody AB_2209751  Anti-RFP (RABBIT) Antibody
Antibody AB_10711040  Abcam, mouse anti-NeuN
Antibody AB_2813835  Abcam, Donkey anti-rat alexa fluour 647
Experiment [Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Delivery of CRISPR/Cas9 editor via bioreducible lipid nanoparticle to the inner ear in Ai14 mice
Guide L2-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System This project aims to advance the NIH Somatic Cell Genome Editing Program’s objective to identify novel delivery technologies that enable genome editing in therapeutically relevant somatic cell populations. We will use proven virus engineering methods to develop new vehicles that can deliver genome editing machinery throughout the adult mammalian central nervous system. Accomplishing this objective would pave the road for applying gene editing, and gene therapy more broadly, to the study and treatment of neurological and psychiatric disorders.
Vector BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2 Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds Deverman Lab
Antibody AB_10015251  Anti-Myosin VIIa antibody, Proteus Biosciences
Antibody AB_2286684  Sox-2 (Y-17) Antibody, Santa Cruz Biotechnology
Genome Editor CleanCap® Cas9 SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. Trilink Biotechnologies
Antibody GFP (D5.1) XP Rabbit mAb antibody
Guide g-loxP2_C9 This sgRNA targets the Ai9 and related transgenes IDT
Guide g-loxPbot_C12a This sgRNA targets the Ai9 and related transgenes at two sites IDT
Vector H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP Gao Lab
Delivery System S10 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Show Experiments (12)
Antibody RRID:AB_310759  rabbit polyclonal antibody against club cell secretory protein, unconjugated, 07-623, EMD
Antibody RRID:AB_2717534  rabbit polyclonal antibody against the pulmonary-associated surfactant protein C (SPC), unconjugated, PA5-71680, Invitrogen
Model System Ai9-SauSpyCas9 mouse Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Baylor College of Medicine
Model System Ai9 mouse (BCM) Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Baylor College of Medicine
Delivery System D237 McCray Lab
Guide BCM_ssAAV5-Sp_sgB This sgRNA targets the Ai9 and related transgenes Vector encoded
Vector ssAAV5-sgB.saCas9 Gao Lab
Genome Editor CleanCap® Fluc Firefly luciferase mRNA capped using CleanCap. It is polyadenylated, modified with 5-methoxyuridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. Trilink Biotechnologies
Vector AAV-Pcsk9
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Vector AAV9-Ai9-sgRNA2-CB-SaCas9 AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Vector AAVcc47_pTR_self comp 2xU6-Ai9 guides AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Asokan Lab
Experiment Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intramuscular administration to rhesus macaques Phase II, AAV9 (n=4) and AAVcc47 (n=4) were administered via intramuscular injection in rhesus macaques and organs were harvested 4 weeks post injection.
Guide JCR183 guide targeting an intronic seqeunce within the Rhesus and human DMD gene AAV encoded (see vector details)
Project Delivery Technologies for In Vivo Genome Editing The difficulty of delivering genome editing agents into many types of cells in animals and patients is a major challenge that must be overcome to realize their full potential to cure genetic diseases. We propose to develop two new strategies for the delivery of genome editing agents into animals and patients that will increase editing efficiency, target cell selectivity, and DNA specificity, as well as a new tool to rapidly and sensitively evaluate the delivery of these agents in mice with minimal effort and expense. These developments will advance the safety and efficacy of genome editing methods for clinical development.
Experiment Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intravenous administration to rhesus macaques Phase I, AAV9 (n=4) and AAVcc47 (n=4) were administered via intravenous injection in rhesus macaques and organs were harvested 4 weeks post injection.
Guide Pcsk9 Exon 1 splice domain Pcsk9 Exon 1 splice domain Synthego
Experiment AAV Tropism project Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging
Project SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice
Show Experiments (1)
Vector AAV7-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Model System TLR-2 mouse R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways. The Jackson Laboratory
Vector AAVrh74-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Experiment [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Delivery of CRISPR/Cas9 via ribonuclear protein (RNP) loaded nanocages (NC) to the brain in Ai14 mice by intracranial bilateral injection. Tissues were harvested 14 days after NC administeration. On-target and off-target editing was assessed.
Antibody RRID:AB_2209751 
Model System C57BL/6 mouse (Asokan study) Unspecified
Vector AAVcc47-mCherry AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter Asokan Lab
Vector AAVcc84-GFP AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter Asokan Lab
Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing Recombinant adeno-associated viruses (AAV) have emerged as safe and effective vectors for clinical gene therapy applications including systemic treatment of neuromuscular diseases such as Spinal Muscular Atrophy (SMA), Duchenne Muscular Dystrophy (DMD), and Giant Axonal Neuropathy (GAN) amongst others. However, genome editing in neuromuscular tissue, in particular, is challenging. The current proposal is on a comprehensive and innovative approach to evolve high potency AAV variants for systemic neuromuscular genome editing.
Show Experiments (9)
Genome Editor AsCas12a (IDT and Feldan Therapeutics) IDT and Feldan Therapeutics
Genome Editor GFP-NLS Nuclear targeted GFP Expressed From (Escherichia coli BL21DE3)
Genome Editor SpCas9 HA-SV40NLS-SpCas9-SV40NLS Vector Encoded
Guide sgAi9R This sgRNA targets the Ai9 and related transgenes IDT
Antibody Anti-RFP (Rabbit) Polyclonal Antibody
Experiment Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.
Delivery System FSD315 Shuttle peptide used to deliver reagents to airway epithelia McCray Lab
Show Experiments (7)
Genome Editor Alt-R™ S.p. Cas9 Nuclease V3 Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. Integrated DNA Technologies (IDT)
Show Experiments (10)
Guide BCM_ssAAV5-Sa_sgB This gRNA targets the Ai9 and related transgenes Vector encoded
Guide SpyCas9 g-loxP2_C9 This sgRNA targets the mTmG transgene IDT
Genome Editor Cre recombinase Cre recombinase delivered by AAV (see vector details)
Experiment Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Delivery of firefly luciferase mRNA via new Lipid NanoParticles by tail vein injection into WT C57BL/6J mice targeting the Liver and delivery is measured by luciferase expression.
Experiment Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Experiment Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.
Vector AAV9-Ai9-sgRNA1-CB-SaCas9 AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Asokan Lab
Vector AAV9-Ai9-sgRNA1 + sgRNA2 AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Asokan Lab
Vector AAV9-CMV-SaCas9 AAV serotype 9 delivering CMV driven SaCas9 Asokan Lab
Vector AAVcc47-Ai9-sgRNA1 + sgRNA2 AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Asokan Lab
Vector AAV9-SaCas9/guide DMD All-in-one vector casette (CMV-saCas9-U6-gRNA [human/rhesus DMD intron]) Asokan/Gersbach Labs
Model System C57BL/6J mouse C57BL/6J WT mouse The Jackson Laboratory
Genome Editor ABE8e Catalytically impaired Cas fused to TadA deaminase Liu Lab
Experiment [Validation] Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver Virus-like particles carrying a CRISPR/Cas base editor and a guide RNA targeting the PSCK9 locus were injected i.v. into male and female mice. One week after injection, the mice were dissected, and genomic DNA isolated from a panel of organs. Targeted NGS was performed to evaluate the degree of editing at the PCSK9 locus in the liver (primary target), and non-target organs. Two potential off-target editing sites (OT6 and OT7) were also sequenced.
Vector AAV3b-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAV5-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAV8-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Guide R26-2 IDT
Experiment Validating Traffic Light Reporter 2 (TLR-2) Mouse Model via Germline Editing Heterozygous embryos containing the traffic light reporter 2 (TLR-2) reporter at the Rosa26 locus were evaluated for activation potential following electroporation of two guide/RNP combinations and transfer to pseudo-pregnant hosts for development to term. Offspring (founders) with activating edits were mated to wild-type females and adult tissues from progeny were assessed for tagRFP fluorescence.
Vector AAVrh10-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Genome Editor CleanCap® Cas9 mRNA (5moU) SpCas9 mRNA with 2 NLS signals, HA tag and capped using CleanCap. It is polyadenylated, substituted with a modified uridine and optimized for mammalian systems. It mimics a fully processed mature mRNA. Trilink Biotechnologies
Antibody RRID:AB_2532994 
Experiment [Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection compared to uninjected control mice. Tissues were harvested 6 days after LNP administeration. On-target and off-target editing was assessed.
Antibody RRID:AB_2813835 
Delivery System 113-O12B combinatorial library cationic lipid nanoparticles Xu lab
Vector AAVcc81-GFP AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter Asokan Lab
Genome Editor SauCas9
Vector AAVcc47-SaCas9-Ai9 AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter Asokan Lab
Experiment [Validation] Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Delivery of CRISPR/Cas9 via RNP-loaded nanocages to the brain in Ai14 mice
Delivery System 306-O12B blank Combinatorial library cationic lipid nanoparticles Xu lab
Experiment [Validation] Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Delivery of CRISPR/Cas9 via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice
Vector AAVcc47-CMV-SaCas9 AAVcc47 delivering CMV driven SaCas9 Asokan Lab
Vector AAV9-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Vector AAVrh8-ZsGreen-Cre AAV backbone with a bi-directional promoter driving zsGreen and Cre Guangping Gao Lab
Show Experiments (1)
Delivery System eVLP engineered virus like particles Liu Lab
Experiment Cre Recombinase dose escalation study in Ai9 mice A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images.
Vector AAV9-CMV-Cre AAV serotype 9 delivering CMV Cre Recombinase Asokan Lab
Vector AAVcc47-CMV-Cre AAVcc47 delivering CMV Cre Recombinase Asokan Lab
Guide Ai14 gRNA This sgRNA targets the Ai9 and related transgenes at multiple sites IDT
Antibody RRID:AB_10711040 
Genome Editor sNLS-SpCas9-sNLS SpCas9 with N- and C-terminal SV40 NLS Aldevron 9212-5MG
Antibody RRID:AB_141607 
Delivery System RNP-NC-no ligand The nanocapsule is a thin glutathione (GSH)-cleavable covalently crosslinked polymer coating around a preassembled ribonucleoprotein (RNP) complex between a Cas9 nuclease and an sgRNA. Gong Lab
Delivery System 306-S10 combinatorial library cationic lipid nanoparticles Xu lab
Delivery System AAV See vector details
Show Experiments (10)
Vector AAV9-GFP AAV2/9 self complementary vector expressing GFP driven by CBh promoter Asokan Lab
Model System Ai14 mouse (congenic) Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory
Experiment [Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.
Guide Ai9 SaCas9 Guide A This gRNA targets the Ai9 and related transgenes Vector encoded
Experiment Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Nanocapusules carrying CRISPR Cas9 RNP with guide RNA targeting the stop sequence in the Ai14 transgene are intracerebrally delivered to Ai14 mice and gene editing is measured by gain of tdTomato protein expression.
Project Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain In vivo genome editing using CRISPR/Cas9 is anticipated to be the next wave of therapeutics for various major health threats, including neurodegenerative diseases. However, to date, very few Cas9-gRNA ribonucleoprotein in vivo delivery methods have been reported, and delivery to the brain has been particularly challenging. The unique nanocapsules we plan to develop will ultimately enable high efficiency neuron-targeted genome editing in the brain, thereby offering new hope to treat devastating neurodegenerative diseases.
Antibody AB_141637  Invitrogen, Donkey anti-rabbit alexa fluor 594
Antibody AB_141607  Invitrogen, Donkey anti-mouse alexafluor 488
Experiment [Validation] Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of CRISPR/Cas9 delivery via bioreducible lipid nanoparticles (LNPs) to the inner ear in Ai14 mice. Subset of mice were administered LNP via canalostomy injection. Control mice were admininstered a blank LNP. Tissues were harvested 6 days after LNP administration. On-target editing was assessed by RFP (tdTomato) signal.
Experiment Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later.
Guide R2-modified This gRNA targets the Ai9 and related transgenes Vector encoded
Vector BI28:AAV-GFAP-SaCas9-WPRE3-pA Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter Deverman Lab
Antibody RRID:AB_1196615  GFP (D5.1) XP Rabbit mAb antibody, Cell Signaling Technology
Project Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors RNA-guided CRISPR genome editing systems promise to revolutionize the treatment of inherited disease. Safe, effective, and target-tissue-specific delivery of the guide RNA that directs editing is a critical hurdle in the development of clinical applications for engineered CRISPR systems. Using strategies validated for the delivery of other categories of nucleic acid therapeutics, we have established a framework for complete chemical modification of CRISPR guides, thereby conferring in vivo stability and effective biodistribution properties. The proposed research will optimize these guides, as well as other editing components, for clinical use.
Show Experiments (11)
Guide STS159 (mTmG; Sp_t2:Sp_c20_mTmG) This sgRNA targets the mTmG transgene In house production
Model System Ai14 mouse Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory
Experiment Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Delivery of Cas9/sgRNA mRNA via new LNPs to the cochlea by cochleostomy and gene editing is measured by percentage of tdTomato positive cells.
Genome Editor SaCas9