Search Result for AAV | SCGE Toolkit

Table View
List View

195 results for AAV

AAV Delivery System - [In Vivo, In Vitro] [Delivery Systems, Biological Effects, AAV tropism] [Human, Mouse] Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice Evolving High Potency AAV Vectors for Neuromuscular Genome Editing name : AAV initiative : AAV tropism deliverySystemName : AAV vectorName : AAV3b-ZsGreen-Cre AAV2/9CMVeGFP AAV2-SaCas9 AAV9-CMV-Cre AAV2-gRNA vectorSubtype : AAV experimentName : AAV tropism in kidney organoids cultured under flow AAV Tropism project AAV tropism in kidney organoids derived from human pluripotent stem cells. See vector details Show Experiments (9) Cre Recombinase dose escalation study in Ai9 mice AAV Tropism project AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids. Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
AAV+Focused Ultrasound Delivery System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: name : AAV+Focused Ultrasound deliverySystemName : AAV+Focused Ultrasound vectorSubtype : AAV See vector details Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
AAV Tropism project Experiment - [In Vivo] [AAV tropism] [Mouse] Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice name : AAV Tropism project initiative : AAV tropism deliverySystemName : AAV vectorName : AAV6-ZsGreen-Cre AAV3b-ZsGreen-Cre AAV4-ZsGreen-Cre AAV8-ZsGreen-Cre AAV5-ZsGreen-Cre description : Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized vectorSubtype : AAV experimentName : AAV Tropism project Lutz Cathleen M , Gao Guang-Ping , Heaney Jason D , Murray Stephen A , Lagor William Raymond , Dickinson Mary E Last Updated Date: 2023-02-10 Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging Show Project SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice
Conklin_Fast-Seq AAV Protocol Protocol Matched Fields: name : Conklin_Fast-Seq AAV Protocol description : Published procedure for AAV composition measurement using fast-seq. Maynard et al. Published procedure for AAV composition measurement using fast-seq. Maynard et al. Fast-Seq: A Simple Method for Rapid and Inexpensive Validation of Packaged Single-Stranded Adeno-Associated Viral Genomes in Academic Settings. Hum Gene Ther Methods . 2019 Dec;30(6):195-205. doi: 10.1089/hgtb.2019.110.
Heaney-SATC_Gao-Validation_Intratracheal Delivery of AAV in Mice Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: name : Heaney-SATC_Gao-Validation_Intratracheal Delivery of AAV in Mice description : Procedure for Intratracheal (IT) delivery of AAV in mouse lung. vectorSubtype : AAV Procedure for Intratracheal (IT) delivery of AAV in mouse lung. Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
AAV tropism in kidney organoids cultured under flow Experiment - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAV tropism in kidney organoids cultured under flow deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV experimentName : AAV tropism in kidney organoids cultured under flow Morizane Ryuji Last Updated Date: 2023-09-22 Human kidney organoids generated from human ES and iPS cells are used to evaluate tropism of AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiation day 21 to 28. Four culture conditions were tested: U-well suspension culture, static culture on gelbrin, low flow on a chip coated with gelbrin, and high flow on a chip coated with gelbrin. Immunohistochemistry was performed to visualize transduced cells with staining for podocytes (PODXL) and proximal tubules (LTL). AAV2/2 shows the highest transduction efficiency among three serotypes evaluated, and the GFP expression is highest in the static condition. Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice Project [AAV tropism] Matched Fields: initiative : AAV tropism name : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice Lutz Cathleen M , Gao Guang-Ping , Heaney Jason D , Murray Stephen A , Lagor William Raymond , Dickinson Mary E Last Updated Date: 2023-02-10 Show Experiments (1) AAV Tropism project
AAV tropism in kidney organoids derived from human pluripotent stem cells. Experiment - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAV tropism in kidney organoids derived from human pluripotent stem cells. deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV experimentName : AAV tropism in kidney organoids derived from human pluripotent stem cells. Morizane Ryuji Last Updated Date: 2023-09-22 Human kidney organoids generated from human ES and iPS cells are used to evaluate tropism of AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiaiton day 21 to 28. Immunohistochemistry is performed to visualize transduced cells with staining for podocytes (PODXL), proximal tubules (LTL), loops of Henle and distal nephrons (CDH1), interstitial stromal cells (PDGFRb), and endothelia (CD31). AAV2/2 shows the highest transduction efficiency among three serotypes evaluated, and the GFP expression is highest in proximal tubular cells. Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
Evolving High Potency AAV Vectors for Neuromuscular Genome Editing Project [Delivery Systems] Matched Fields: name : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing description : Recombinant adeno-associated viruses (AAV) have emerged as safe and effective vectors for clinical gene The current proposal is on a comprehensive and innovative approach to evolve high potency AAV variants Asokan Aravind Last Updated Date: 2020-11-19 Recombinant adeno-associated viruses (AAV) have emerged as safe and effective vectors for clinical gene therapy applications including systemic treatment of neuromuscular diseases such as Spinal Muscular Atrophy (SMA), Duchenne Muscular Dystrophy (DMD), and Giant Axonal Neuropathy (GAN) amongst others. However, genome editing in neuromuscular tissue, in particular, is challenging. The current proposal is on a comprehensive and innovative approach to evolve high potency AAV variants for systemic neuromuscular genome editing. Show Experiments (7) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: name : Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular vectorName : AAVcc47-Cre AAVcc47-SaCas9-Ai9 description : Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. vectorSubtype : AAV experimentName : Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Heaney Jason D Last Updated Date: 2021-03-30 Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues. Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Asokan Validation (Asokan, Aravind)
11. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing. Publication - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing name : Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing vectorName : AAV9_pTR_self comp 2xU6-Ai9 guides AAV9-CMV-SaCas9 description : Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing Effective clinical translation is confounded, at least in part, by differences in AAV biology across Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques potent, cross-species compatible variant (AAV.cc47) that shows improved attributes benchmarked against AAV modeling in preclinical studies, but also clinical translatability by broadening the therapeutic window of AAV vectorSubtype : AAV Gonzalez TJ, Simon KE, Blondel LO, Fanous MM, Roger AL, Maysonet MS, Devlin GW, Smith TJ, Oh DK, Havlik LP, Castellanos Rivera RM, Piedrahita JA, ElMallah MK, Gersbach CA, Asokan A PII: 10.1038/s41467-022-33745-4, PUBMED 36210364, PMC PMC9548504, DOI 10.1038/s41467-022-33745-4 ABSTRACT: Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attrib ... SCGE data tags... Organisms: Mouse; Models: Ai9 mouse; Editors SaCas9-Lagor; Vectors AAV9-CMV-Cre; AAVcc47-CMV-Cre; AAV9-Ai9-sgRNA2-CB-SaCas9; AAVcc47-Ai9-sgRNA1-CB-SaCas9; AAVcc47-Ai9-sgRNA2-CB-SaCas9; AAV9-Ai9-sgRNA1-CB-SaCas9; AAV9-CMV-SaCas9; AAVcc47-Ai9-sgRNA1 + sgRNA2; AAVcc47-CMV-SaCas9; AAV9-Ai9-sgRNA1 + sgRNA2; AAVcc47_pTR_self comp 2xU6-Ai9 guides; AAV9_pTR_self comp 2xU6-Ai9 guides; Projects Evolving High Potency AAV Vectors for Neuromuscular Genome Editing Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: name : compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV vectorName : AAV-Pcsk9 description : AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. experimentName : compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV Chaikof Elliot L. Last Updated Date: 2022-04-15 On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10. Show Project Delivery Technologies for In Vivo Genome Editing
AAVS1_site_04 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_04 grnaLabId : AAVS1_site_04 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAVS1_site_06 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_06 grnaLabId : AAVS1_site_06 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAVS1_site_01 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_01 grnaLabId : AAVS1_site_01 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAVS1_site_03 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_03 grnaLabId : AAVS1_site_03 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAVS1_site_08 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_08 grnaLabId : AAVS1_site_08 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAVS1_site_09 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_09 grnaLabId : AAVS1_site_09 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAVS1_site_13 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_13 grnaLabId : AAVS1_site_13 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAVS1_site_14 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_14 grnaLabId : AAVS1_site_14 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Experiment - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS deliverySystemName : AAV vectorName : AAV2/2CMVeGFP vectorSubtype : AAV Morizane Ryuji Last Updated Date: 2023-09-22 Human kidney orgnaoids generated from human ES and iPS cells are used to evaluate tropism of AAV2 that expresses eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiation day 22 to 23. Four culture conditions are tested: full flow on a chip, pulsed flow on a chip, no flow on a chip, U-well suspension culture. Flow cytometry is performed to quantify the transduction efficiency in LTL+ proximal tubules. U-well culture shows the highest transduction efficiency among those four conditions. Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
AAVS1_site_02 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_02 grnaLabId : AAVS1_site_02 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAVS1_site_07 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_07 grnaLabId : AAVS1_site_07 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAVS1_site_10 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_10 grnaLabId : AAVS1_site_10 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAVS1_site_11 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_11 grnaLabId : AAVS1_site_11 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAVS1_site_12 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_12 grnaLabId : AAVS1_site_12 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAVS1_site_05 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: name : AAVS1_site_05 grnaLabId : AAVS1_site_05 guideTargetLocus : AAVS1 Targets AAVS1 safe harbor locus Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
AAV2-SaCas9 Vector - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV symbol : AAV2-SaCas9 vectorName : AAV2-SaCas9 AAV2-gRNA description : AAV expressing S. aureus Cas9 under control of the CMV promoter vectorSubtype : AAV AAV expressing S. aureus Cas9 under control of the CMV promoter Show Experiments (1) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.
AAV9-Ai9-sgRNA2-CB-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9-Ai9-sgRNA2-CB-SaCas9 vectorName : AAV9-Ai9-sgRNA2-CB-SaCas9 AAV9-Ai9-sgRNA1-CB-SaCas9 description : AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus vectorSubtype : AAV AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAV9-CMV-Cre Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing deliverySystemName : AAV symbol : AAV9-CMV-Cre vectorName : AAV9-CMV-Cre description : AAV serotype 9 delivering CMV Cre Recombinase vectorSubtype : AAV AAV serotype 9 delivering CMV Cre Recombinase Show Experiments (1) Cre Recombinase dose escalation study in Ai9 mice
AAV9-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice initiative : AAV tropism deliverySystemName : AAV symbol : AAV9-ZsGreen-Cre vectorName : AAV9-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV experimentName : AAV Tropism project AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAVcc47-SaCas9-Ai9 Vector - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: symbol : AAVcc47-SaCas9-Ai9 vectorName : AAVcc47-SaCas9-Ai9 vectorSubtype : AAV experimentName : Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
AAV.pU1a-SpCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV.pU1a-SpCas9 vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
AAV9-Ai9-sgRNA1-CB-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9-Ai9-sgRNA1-CB-SaCas9 vectorName : AAV9-Ai9-sgRNA2-CB-SaCas9 AAV9-Ai9-sgRNA1-CB-SaCas9 description : AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus vectorSubtype : AAV AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAVcc47_pTR_self comp 2xU6-Ai9 guides Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc47_pTR_self comp 2xU6-Ai9 guides vectorName : AAV9-CMV-SaCas9 AAVcc47_pTR_self comp 2xU6-Ai9 guides vectorSubtype : AAV AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
AAVcc81-GFP Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc81-GFP vectorName : AAVcc81-GFP vectorSubtype : AAV AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAV2/9CMVeGFP Vector - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV symbol : AAV2/9CMVeGFP vectorName : AAV2/9CMVeGFP vectorSubtype : AAV experimentName : AAV tropism in kidney organoids cultured under flow AAV tropism in kidney organoids derived from human pluripotent stem cells. CMV-eGFP Show Experiments (4) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.
AAV8-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice initiative : AAV tropism deliverySystemName : AAV symbol : AAV8-ZsGreen-Cre vectorName : AAV8-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV experimentName : AAV Tropism project AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAV9_pTR_self comp 2xU6-Ai9 guides Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9_pTR_self comp 2xU6-Ai9 guides vectorName : AAV9_pTR_self comp 2xU6-Ai9 guides AAV9-CMV-SaCas9 description : AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting vectorSubtype : AAV AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAVrh10-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice initiative : AAV tropism deliverySystemName : AAV symbol : AAVrh10-ZsGreen-Cre vectorName : AAVrh10-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV experimentName : AAV Tropism project AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAV2/2CMVeGFP Vector - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV symbol : AAV2/2CMVeGFP vectorName : AAV2/2CMVeGFP vectorSubtype : AAV experimentName : AAV tropism in kidney organoids cultured under flow AAV tropism in kidney organoids derived from human pluripotent stem cells. CMV-eGFP Show Experiments (5) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.
AAV2/8CMVeGFP Vector - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV symbol : AAV2/8CMVeGFP vectorName : AAV2/8CMVeGFP vectorSubtype : AAV experimentName : AAV tropism in kidney organoids cultured under flow AAV tropism in kidney organoids derived from human pluripotent stem cells. CMV-eGFP Show Experiments (4) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.
AAV5-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice initiative : AAV tropism deliverySystemName : AAV symbol : AAV5-ZsGreen-Cre vectorName : AAV5-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV experimentName : AAV Tropism project AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAV7-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice initiative : AAV tropism deliverySystemName : AAV symbol : AAV7-ZsGreen-Cre vectorName : AAV7-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV experimentName : AAV Tropism project AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAV9-mCherry Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9-mCherry vectorName : AAV9-mCherry vectorSubtype : AAV AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter Show Experiments (1) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1 vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAV6-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice initiative : AAV tropism deliverySystemName : AAV symbol : AAV6-ZsGreen-Cre vectorName : AAV6-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV experimentName : AAV Tropism project AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAV9-GFP Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9-GFP vectorName : AAV9-GFP vectorSubtype : AAV AAV2/9 self complementary vector expressing GFP driven by CBh promoter Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
AAVcc47-Ai9-sgRNA1-CB-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc47-Ai9-sgRNA1-CB-SaCas9 vectorName : AAVcc47-Ai9-sgRNA2-CB-SaCas9 AAVcc47-Ai9-sgRNA1-CB-SaCas9 vectorSubtype : AAV AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAVcc47-Ai9-sgRNA1 + sgRNA2 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc47-Ai9-sgRNA1 + sgRNA2 vectorName : AAVcc47-Ai9-sgRNA1 + sgRNA2 AAVcc47-CMV-SaCas9 description : AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus vectorSubtype : AAV AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
AAVcc47-Ai9-sgRNA2-CB-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc47-Ai9-sgRNA2-CB-SaCas9 vectorName : AAVcc47-Ai9-sgRNA2-CB-SaCas9 AAVcc47-Ai9-sgRNA1-CB-SaCas9 vectorSubtype : AAV AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
AAV4-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice initiative : AAV tropism deliverySystemName : AAV symbol : AAV4-ZsGreen-Cre vectorName : AAV4-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV experimentName : AAV Tropism project AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAV9-CMV-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9-CMV-SaCas9 vectorName : AAV9_pTR_self comp 2xU6-Ai9 guides AAV9-Ai9-sgRNA1 + sgRNA2 AAV9-CMV-SaCas9 AAVcc47_pTR_self comp 2xU6-Ai9 guides description : AAV serotype 9 delivering CMV driven SaCas9 vectorSubtype : AAV AAV serotype 9 delivering CMV driven SaCas9 Show Experiments (3) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
AAVcc84-GFP Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc84-GFP vectorName : AAVcc84-GFP vectorSubtype : AAV AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
AAVrh8-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice initiative : AAV tropism deliverySystemName : AAV symbol : AAVrh8-ZsGreen-Cre vectorName : AAVrh8-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV experimentName : AAV Tropism project AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAV2-gRNA Vector - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV symbol : AAV2-gRNA vectorName : AAV2-SaCas9 AAV2-gRNA description : AAV expressing two sgRNAs targeting human DMD under control of U6 promoters and mCherry under control vectorSubtype : AAV AAV expressing two sgRNAs targeting human DMD under control of U6 promoters and mCherry under control of the CMV promoter; pAAV[2gRNA]-mCherry-U6>{SagRNA#1*}:{SagRNA#2} Show Experiments (2) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
AAVcc47-CMV-Cre Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing deliverySystemName : AAV symbol : AAVcc47-CMV-Cre vectorName : AAVcc47-CMV-Cre vectorSubtype : AAV AAVcc47 delivering CMV Cre Recombinase Show Experiments (1) Cre Recombinase dose escalation study in Ai9 mice
AAVcc47-mCherry Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc47-mCherry vectorName : AAVcc47-mCherry vectorSubtype : AAV AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter Show Experiments (1) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAV3b-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice initiative : AAV tropism deliverySystemName : AAV symbol : AAV3b-ZsGreen-Cre vectorName : AAV3b-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV experimentName : AAV Tropism project AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAV9-Ai9-sgRNA1 + sgRNA2 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAV9-Ai9-sgRNA1 + sgRNA2 vectorName : AAV9-Ai9-sgRNA1 + sgRNA2 AAV9-CMV-SaCas9 description : AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus vectorSubtype : AAV AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2 vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAVrh74-ZsGreen-Cre Vector - [In Vivo] [AAV tropism] [Mouse] Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice initiative : AAV tropism deliverySystemName : AAV symbol : AAVrh74-ZsGreen-Cre vectorName : AAVrh74-ZsGreen-Cre description : AAV backbone with a bi-directional promoter driving zsGreen and Cre vectorSubtype : AAV experimentName : AAV Tropism project AAV backbone with a bi-directional promoter driving zsGreen and Cre Show Experiments (1) AAV Tropism project
AAVcc47-Cre Vector - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: symbol : AAVcc47-Cre vectorName : AAVcc47-Cre vectorSubtype : AAV experimentName : Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular AAV2/5 expressing Cre recombinase Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2 Vector - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2 vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2 description : AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2.gb AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
AAVcc47-CMV-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing symbol : AAVcc47-CMV-SaCas9 vectorName : AAVcc47-Ai9-sgRNA1 + sgRNA2 AAVcc47-CMV-SaCas9 vectorSubtype : AAV AAVcc47 delivering CMV driven SaCas9 Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
AAV-Pcsk9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: symbol : AAV-Pcsk9 vectorName : AAV-Pcsk9 experimentName : compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV Show Experiments (1) On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
SpCas9 Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Biological Effects] [Human, Mouse] Matched Fields: grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 vectorName : AAV.pU1a-SpCas9 PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV guideTargetLocus : AAVS1 HA-SV40NLS-SpCas9-SV40NLS Show Experiments (4) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway A novel human T cell platform to define biological adverse effects of genome editing Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
CD4/CD8 Human Primary T cell Model System - [In Vitro] [Biological Effects] [Human] Matched Fields: grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 guideTargetLocus : AAVS1 CD4/CD8 Human Primary T cell Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
A novel human T cell platform to define biological adverse effects of genome editing Experiment - [In Vitro] [Biological Effects] [Human] Matched Fields: grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 guideTargetLocus : AAVS1 Tsai Shengdar Q Last Updated Date: 2020-12-09 110 guide RNAs and SpCas9 were transfected into human T-cells. Indel rates were measured by targeted amplicon deep sequencing. Show Project A Novel Human T-Cell Platform to Define Biological Effects of Genome Editing
P3 Nucleofection Kit Delivery System - [In Vitro] [Biological Effects] [Human] Matched Fields: grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 guideTargetLocus : AAVS1 Nuceleofection kit to be used with Lonza's nucleofection system. Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Tsai_T Cell Transfection Protocol Protocol - [In Vitro] [Biological Effects] [Human] Matched Fields: grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 guideTargetLocus : AAVS1 Procedure for T cell transfection. Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
83. CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity. Publication - [In Vitro] [Biological Effects] [Human] Matched Fields: grnaLabId : AAVS1_site_14 AAVS1_site_13 AAVS1_site_12 AAVS1_site_11 AAVS1_site_10 guideTargetLocus : AAVS1 Lazzarotto CR, Malinin NL, Li Y, Zhang R, Yang Y, Lee G, Cowley E, He Y, Lan X, Jividen K, Katta V, Kolmakova NG, Petersen CT, Qi Q, Strelcov E, Maragh S, Krenciute G, Ma J, Cheng Y, Tsai SQ PII: 10.1038/s41587-020-0555-7, PUBMED 32541958, PMC PMC7652380, MID NIHMS1591991, DOI 10.1038/s41587-020-0555-7 ABSTRACT: Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily scalable to the throughput needed to fully understand the principles that govern Cas9 specificity. Here we describe 'circularization for high-throughput analysis of nuclease genome-wide effects by sequencing' (CHANGE-seq), a scalable, automatable tagmentation-based method for measuring the genome-wide activity of Cas9 in vitro. We applied CHANGE-seq to 110 single guide RNA targets across 13 thera ... SCGE data tags... Projects A Novel Human T-Cell Platform to Define Biological Effects of Genome Editing
Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids. Experiment - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV name : Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids. Morizane Ryuji Last Updated Date: 2023-09-22 Human kidney organoids generated from human iPS cells are used to evaluate toxicity induced by AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 . KIM-1 levels were measured using Luminex (Bioplex 200). Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
demo VV04-Cre Vector [Mouse] Matched Fields: deliverySystemName : AAV DEMO viral vector for demo purpose
Human kidney organoid (ESC-derived) Model System - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV Kidney organoid derived from human female H9 embryonic stem cells Show Experiments (1) Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids.
RRID:AB_2336558 Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2-SaCas9 AAV2/8CMVeGFP AAV2-gRNA vectorSubtype : AAV experimentName : AAV tropism in kidney organoids cultured under flow AAV tropism in kidney organoids derived from human pluripotent stem cells. Other Id: RRID:AB_2336558 B-1325-2 (Vector Labs) Lotus tetragonolobus lectin (LTL) Show Experiments (4) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.
RRID:AB_298118 Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV experimentName : AAV tropism in kidney organoids derived from human pluripotent stem cells. Other Id: ab11512 (Abcam) RRID:AB_298118 Rat anti-e-cadherin monoclonal antibody Show Experiments (1) AAV tropism in kidney organoids derived from human pluripotent stem cells.
RRID:AB_2118010 Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2-gRNA vectorSubtype : AAV Other Id: RRID:AB_2118010 Cell Signaling Technology Cat# 2577 Rabbit anti-Phospho-Histone H2A.X (Ser139) Show Experiments (1) Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
SaCas9 (AAV-SaCas9) Genome Editor - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA description : SaCas9 delivered by AAV-SaCas9 vector vectorSubtype : AAV SaCas9 delivered by AAV-SaCas9 vector Show Experiments (2) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-Ai9-sgRNA2-CB-SaCas9 AAVcc47-Ai9-sgRNA2-CB-SaCas9 AAVcc47-Ai9-sgRNA1-CB-SaCas9 AAV9-Ai9-sgRNA1-CB-SaCas9 vectorSubtype : AAV name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
RRID:AB_10563941 Antibody [Mouse] Matched Fields: deliverySystemName : AAV+Focused Ultrasound Other Id: Invitrogen, R10367 RRID:AB_10563941 Polyclonal rabbit anti-RFP antibody
Testing AAV5 for activation of tdTomato in mouse airway Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV name : Testing AAV5 for activation of tdTomato in mouse airway Gao Guang-Ping Last Updated Date: 2020-10-20 AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Experiment - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA vectorSubtype : AAV name : Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Morizane Ryuji Last Updated Date: 2023-09-22 An AAV2 viral vector carrying SaCas9 and AAV2 vector expressing mCherry and carrying two gRNAs against the DMD gene were used in human kidney organoids to assess transgene delivery to nephron epithelia. Organoids were treated with both AAVs at MOI 10^5 for one week. Delivery of Cas9 and gRNA vectors to nephron cell types were evaluted by immunohistochemistry. Note: additional data not shown demonstrated mCherry and SaCas9 were not detectable in non-transduced cells. Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9_pTR_self comp 2xU6-Ai9 guides AAV9-CMV-SaCas9 AAVcc47_pTR_self comp 2xU6-Ai9 guides vectorSubtype : AAV name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
RRID:AB_354920 Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV experimentName : AAV tropism in kidney organoids cultured under flow AAV tropism in kidney organoids derived from human pluripotent stem cells. Other Id: RRID:AB_354920 AF1658 (R&D Systems) Goat anti-podocalyxin polyclonal antibody Show Experiments (2) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow
Cre recombinase Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing deliverySystemName : AAV vectorName : AAVcc47-Cre AAV9-CMV-Cre AAVcc47-CMV-Cre description : Cre recombinase delivered by AAV (see vector details) vectorSubtype : AAV experimentName : Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Cre recombinase delivered by AAV (see vector details) Show Experiments (4) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Cre Recombinase dose escalation study in Ai9 mice Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
RRID:AB_307284 Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV experimentName : AAV tropism in kidney organoids derived from human pluripotent stem cells. Other Id: RRID:AB_307284 ab9498 (Abcam) Mouse anti-CD31 monoclonal antibody Show Experiments (1) AAV tropism in kidney organoids derived from human pluripotent stem cells.
DMD low gRNA-2 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA description : One of two low-off target gRNAs delivred by dual gRNA AAV vector AAV-gRNA vectorSubtype : AAV One of two low-off target gRNAs delivred by dual gRNA AAV vector AAV-gRNA Show Experiments (2) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Ai9 mouse Model System - [In Vivo] [Delivery Systems, AAV tropism, Animal Reporter and Testing Center] [Mouse] Matched Fields: study : SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice Evolving High Potency AAV Vectors for Neuromuscular Genome Editing initiative : AAV tropism deliverySystemName : AAV AAV+Focused Ultrasound vectorName : AAVrh8-ZsGreen-Cre AAVcc47-CMV-SaCas9 AAV9-CMV-SaCas9 AAV6-ZsGreen-Cre AAV4-ZsGreen-Cre vectorSubtype : AAV capsidSerotype : AAV BI28 (novel engineered variant) experimentName : AAV Tropism project Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
RRID:AB_300798 Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV experimentName : AAV tropism in kidney organoids cultured under flow AAV tropism in kidney organoids derived from human pluripotent stem cells. Other Id: ab13970 (Abcam) RRID:AB_300798 Chicken anti-GFP polyclonal antibody Show Experiments (3) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS
Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-Ai9-sgRNA1 + sgRNA2 AAVcc47-Ai9-sgRNA1 + sgRNA2 AAVcc47-CMV-SaCas9 AAV9-CMV-SaCas9 description : single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV vectorSubtype : AAV name : Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
demo VV05-Cre Vector [Mouse] Matched Fields: deliverySystemName : AAV DEMO viral vector for demo purpose
Human kidney organoid (stem cell-derived) Model System - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2-SaCas9 AAV2/8CMVeGFP AAV2-gRNA vectorSubtype : AAV experimentName : AAV tropism in kidney organoids cultured under flow AAV tropism in kidney organoids derived from human pluripotent stem cells. Kidney organoid derived from human female H9 ES or BJFF iPS cells Show Experiments (4) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Testing AAV5 for activation of tdTomato in HEK293T cells Experiment - [In Vitro] [Delivery Systems] [Human] Matched Fields: vectorName : PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) description : AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T name : Testing AAV5 for activation of tdTomato in HEK293T cells Gao Guang-Ping Last Updated Date: 2020-10-20 AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence. Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System Project [Delivery Systems] Matched Fields: name : Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Deverman Benjamin E Last Updated Date: 2021-04-17 This project aims to advance the NIH Somatic Cell Genome Editing Program’s objective to identify novel delivery technologies that enable genome editing in therapeutically relevant somatic cell populations. We will use proven virus engineering methods to develop new vehicles that can deliver genome editing machinery throughout the adult mammalian central nervous system. Accomplishing this objective would pave the road for applying gene editing, and gene therapy more broadly, to the study and treatment of neurological and psychiatric disorders. Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Cre Recombinase dose escalation study in Ai9 mice Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing deliverySystemName : AAV vectorName : AAV9-CMV-Cre AAVcc47-CMV-Cre vectorSubtype : AAV Asokan Aravind Last Updated Date: 2021-09-16 A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA vectorSubtype : AAV Other Id: mouse anti-saCas9 monoclonal antibody Show Experiments (1) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.
RRID:AB_2750570 Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2-gRNA vectorSubtype : AAV Other Id: RRID:AB_2750570 Active Motif Cat# 39795 Mouse anti-meis1/2/3 Show Experiments (1) Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
RRID:AB_2116561 Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2-gRNA vectorSubtype : AAV Other Id: RRID:AB_2116561 R and D Systems Cat# AF1750 Goat anti-KIM1/HAVCR Show Experiments (1) Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
RRID:AB_777165 Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV experimentName : AAV tropism in kidney organoids derived from human pluripotent stem cells. Other Id: ab32570 (Abcam) RRID:AB_777165 Rabbit anti-PDGFRb monoclonal antibody Show Experiments (1) AAV tropism in kidney organoids derived from human pluripotent stem cells.
Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids. Experiment - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2-gRNA vectorSubtype : AAV name : Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 Morizane Ryuji Last Updated Date: 2023-09-22 AAV2 that carries saCas9 and AAV2 carrying two gRNAs against DMD gene and mCherry were used in kidney organoids to assess toxicity compared to AAV2-GFP or mock transduced kidney organoids. Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
demo VV03-Cre Vector [Mouse] Matched Fields: deliverySystemName : AAV DEMO viral vector for demo purpose
Human kidney organoid (iPSC-derived) Model System - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV Kidney organoid derived from human male BJFF iPS cells Show Experiments (2) AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.
Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA vectorSubtype : AAV Other Id: mouse anti-saCas9 monoclonal antibody Show Experiments (1) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.
RRID:AB_2336558 Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2-gRNA vectorSubtype : AAV Other Id: Vector Laboratories Cat# B-1325 RRID:AB_2336558 Lotus tetragonolobus lectin (LTL) Show Experiments (1) Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
C57BL/6 mouse (Asokan study) Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-mCherry AAVcc47-mCherry AAVcc84-GFP AAVcc81-GFP AAV9-GFP vectorSubtype : AAV Show Experiments (2) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAVcc84-GFP AAVcc81-GFP AAV9-GFP vectorSubtype : AAV Asokan Aravind Last Updated Date: 2020-11-19 C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
SaCas9-Lagor Genome Editor - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-Ai9-sgRNA2-CB-SaCas9 AAVcc47-Ai9-sgRNA2-CB-SaCas9 AAV9-Ai9-sgRNA1 + sgRNA2 AAVcc47-CMV-SaCas9 AAV9-CMV-SaCas9 vectorSubtype : AAV Show Experiments (4) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
SauCas9 Genome Editor - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorName : AAVcc47-SaCas9-Ai9 vectorSubtype : AAV experimentName : Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
FUS (focused ultrasound) array validation in Ai9 mice Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: deliverySystemName : AAV+Focused Ultrasound vectorSubtype : AAV Leong Kam W Last Updated Date: 2022-04-15 9.3 week-old Ai9 mice (4 male and 4 female) were administered Ai9-targeting SaCas9 AAV9 vector through intravenous adminsitration (2E12 vg/mouse) and left hemisphere was targeted by FUS (focused ultrasound) array for BBB (blood brain barrier) opening Show Project Focused Ultrasound-mediated Delivery of Gene-editing Elements to the Brain for Neurodegenerative Disorders
RRID:AB_2762834 Antibody Matched Fields: deliverySystemName : AAV+Focused Ultrasound Other Id: RRID:AB_2762834 ThermoFisher #A32794 Alexa fluor 555, Donkey anti-rabbit
RRID:AB_141607 Antibody Matched Fields: deliverySystemName : AAV+Focused Ultrasound Other Id: RRID:AB_141607 Thermofisher #A21202 Alexa fluor 488, Donkey anti-mouse
Deverman_Comprehensive Methods Protocol - [In Vivo, In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 description : Procedure for plasmid cloning, editing evaluation in fibroblast, AAV production and administration, tissue vectorSubtype : AAV vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb capsidSerotype : AAV BI28 (novel engineered variant) Procedure for plasmid cloning, editing evaluation in fibroblast, AAV production and administration, tissue processing and IHC. Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
SaCas9 Genome Editor - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: deliverySystemName : AAV+Focused Ultrasound vectorSubtype : AAV Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Sa_Ai9_L Guide - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: deliverySystemName : AAV+Focused Ultrasound vectorSubtype : AAV This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Sa_Ai9_R Guide - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: deliverySystemName : AAV+Focused Ultrasound vectorSubtype : AAV This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Ai9LR21-SaCas9 Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: deliverySystemName : AAV+Focused Ultrasound vectorSubtype : AAV AAV9 encoding S. aureus Cas9 and two guide RNAs with modified scaffolds Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
RRID:AB_10711040 Antibody Matched Fields: deliverySystemName : AAV+Focused Ultrasound Other Id: Abcam, ab104224 RRID:AB_10711040 Mouse monoclonal [1B7] to NeuN - Neuronal Marker
Deverman_AAV Production and Administration Protocol Protocol - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 description : Published procedures for AAV production, delivery, and tissue imaging. Challis et al. Systemic AAV vectors for widespread and targeted gene delivery in rodents. vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb Published procedures for AAV production, delivery, and tissue imaging. Challis et al. Systemic AAV vectors for widespread and targeted gene delivery in rodents. Nat Protoc. 2019 Feb;14(2):379-414. doi: 10.1038/s41596-018-0097-3. Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Ai9 SaCas9 Guide A Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorName : AAVcc47-SaCas9-Ai9 vectorSubtype : AAV experimentName : Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular This gRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Ai9 SaCas9 Guide B Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorName : AAVcc47-SaCas9-Ai9 vectorSubtype : AAV experimentName : Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular This gRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: description : Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing vectorSubtype : AAV name : Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to capsidSerotype : AAV BI28 (novel engineered variant) Heaney Jason D Last Updated Date: 2023-05-10 Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Deverman Validation (Deverman, Benjamin)
Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-mCherry AAVcc47-mCherry vectorSubtype : AAV Asokan Aravind Last Updated Date: 2020-11-19 C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
DMD low gRNA-1 Guide - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA description : One of two low-off target gRNAs delivred by dual gRNA AAV vector pAAV[2gRNA]-mCherry-U6>{SagRNA#1}:{ vectorSubtype :* AAV One of two low-off target gRNAs delivred by dual gRNA AAV vector pAAV[2gRNA]-mCherry-U6>{SagRNA#1*}:{SagRNA#2} Show Experiments (1) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.
Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: description : 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 vectorSubtype : AAV capsidSerotype : AAV BI28 (novel engineered variant) Deverman Benjamin E Last Updated Date: 2021-04-17 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later. Show Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System
BI28:AAV-GFAP-SaCas9-WPRE3-pA Vector - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: description : Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein vectorSubtype : AAV capsidSerotype : AAV BI28 (novel engineered variant) Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Experiment - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2/2CMVeGFP AAV2/9CMVeGFP AAV2/8CMVeGFP vectorSubtype : AAV name : Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids Morizane Ryuji Last Updated Date: 2023-09-22 Human kidney organoids generated from human ES are used to evaluate toxicity and inflammation induced by AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 . MCP-1 and KIM-1 levels were measured using Luminex (Bioplex 200). Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
demo VV01-Cre Vector [Mouse] Matched Fields: deliverySystemName : AAV DEMO viral vector for demo purpose
demo VV02-Cre Vector [Mouse] Matched Fields: deliverySystemName : AAV DEMO viral vector for demo purpose
RRID:AB_2722769 Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2-SaCas9 AAV2-gRNA vectorSubtype : AAV Other Id: ab205402 (Abcam) RRID:AB_2722769 Chicken anti-mCherry antibody Show Experiments (1) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.
RRID:AB_307284 Antibody - [In Vitro] [Biological Effects] [Human] Matched Fields: deliverySystemName : AAV vectorName : AAV2-gRNA vectorSubtype : AAV Other Id: RRID:AB_307284 Abcam Cat# ab9498 Mouse anti-CD31 antibody Show Experiments (1) Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: study : Evolving High Potency AAV Vectors for Neuromuscular Genome Editing vectorName : AAV9-Ai9-sgRNA1 + sgRNA2 AAVcc47-Ai9-sgRNA1 + sgRNA2 AAVcc47-CMV-SaCas9 AAV9-CMV-SaCas9 description : single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV vectorSubtype : AAV name : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to Asokan Aravind Last Updated Date: 2021-09-16 A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2 Vector - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: description : Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP vectorSubtype : AAV capsidSerotype : AAV BI28 (novel engineered variant) Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
SaLoxP1-modified Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1.gb This gRNA targets the mTmG, Ai9 and related transgenes at two sites Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells Experiment - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV name : Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells Gao Guang-Ping Last Updated Date: 2021-09-21 AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types. Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
TadA-8e V106W Genome Editor - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-Pcsk9 experimentName : compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W) Show Experiments (2) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
SaCas9 Genome Editor - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorSubtype : AAV vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb capsidSerotype : AAV BI28 (novel engineered variant) Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Deverman_Area Based Quantification of Editing Efficiency Protocol Protocol - [In Vivo, In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorSubtype : AAV vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb capsidSerotype : AAV BI28 (novel engineered variant) Procedure for non-IHC based image quantification of editing. Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
C57BL/6J mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-Pcsk9 experimentName : compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV C57BL/6J WT mouse Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
L3-modifed Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3.gb This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
eVLP Delivery System - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: experimentName : compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV engineered virus like particles Show Experiments (3) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Experiment - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb Deverman Benjamin E Last Updated Date: 2021-04-17 Reporter transgene activation by SaCas9 gRNA target and modified scaffold sequences by transient transfection in immortalized Ai9 mouse fibroblasts Show Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System
L2-unmodified Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
R1-modified Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1.gb This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
R1-unmodified Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3.gb This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
L3-unmodified Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3.gb This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
R2-modified Guide - [In Vivo, In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1 vectorSubtype : AAV vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1.gb capsidSerotype : AAV BI28 (novel engineered variant) This gRNA targets the Ai9 and related transgenes Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
R2-unmodified Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3.gb This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
L1-modified Guide - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1 vectorSubtype : AAV vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1.gb capsidSerotype : AAV BI28 (novel engineered variant) This gRNA targets the Ai9 and related transgenes Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
L1-unmodified Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb This gRNA targets the Ai9 and related transgenes Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
L2-modified Guide - [In Vivo, In Vitro] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2 vectorSubtype : AAV vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2.gb AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2.gb capsidSerotype : AAV BI28 (novel engineered variant) This gRNA targets the Ai9 and related transgenes Show Experiments (2) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
SaLoxP2-unmodified Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2.gb This gRNA targets the mTmG, Ai9 and related transgenes at two sites Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
SaLoxP1-unmodified Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1.gb This gRNA targets the mTmG, Ai9 and related transgenes at two sites Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Chaikof-Associated Protocol 2_Off-target editing AND Primers for sequencing analysis Protocol - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-Pcsk9 experimentName : compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV This protocol describes in vivo adminstration and subsequent analysis of off-target editing in the liver. Show Experiments (1) On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing Project [Biological Effects] Matched Fields: description : We will optimize kidney organoid generation and AAV transduction for assessment of adverse effects of Morizane Ryuji Last Updated Date: 2023-09-22 The proposed work will take advantage of the state-of-the-art technology of kidney organoids that we recently generated from human pluripotent stem cells (hPSCs) and further advance this technology toward the goal of establishing kidney tissue platforms for assessment of somatic genome editing. We will optimize kidney organoid generation and AAV transduction for assessment of adverse effects of CRISR genome editing. Further, we will incorporate the 3D-printed vascular system into kidney organoids to simulate in vivo pharmacokinetics and pharmacodynamics on chips. Show Experiments (7) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids. Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Ai9 mouse (BCM) Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorName : AAVcc47-Cre AAVcc47-SaCas9-Ai9 vectorSubtype : AAV experimentName : Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Ai9 mouse immortalized fibroblasts Model System - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1.gb AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2.gb Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV Other Id: Anti-RFP (RABBIT) Antibody Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV Other Id: Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300 Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Heaney_SATC Tissue Processing, Imaging and Analysis Protocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorName : AAVcc47-Cre AAVcc47-SaCas9-Ai9 vectorSubtype : AAV capsidSerotype : AAV BI28 (novel engineered variant) experimentName : Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Procedure for tissue preparation, imaging and analysis. Show Experiments (4) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
sgAi9R Guide - [In Vivo, In Vitro] [Delivery Systems] [Human, Mouse] Matched Fields: vectorName : AAV.pU1a-SpCas9 PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV This sgRNA targets the Ai9 and related transgenes Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
SaLoxP2-modified Guide - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2 vectorAnnotatedMap : AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2.gb This gRNA targets the mTmG, Ai9 and related transgenes at two sites Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV Other Id: Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000 Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV Other Id: GFP (D5.1) XP Rabbit mAb antibody Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
pH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) Vector - [In Vitro] [Delivery Systems] [Human] Matched Fields: vectorName : PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
HEK-293T with Ai9 transient reporter assay Model System - [In Vitro] [Delivery Systems] [Human] Matched Fields: vectorName : PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Lipofectamine 3000 Delivery System - [In Vitro] [Delivery Systems, Genome Editors] [Human] Matched Fields: vectorName : PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) Lipid nanoparticle Show Experiments (2) Testing newly discovered Biggie Phage editors in human cells Testing AAV5 for activation of tdTomato in HEK293T cells
sgAi9L Guide - [In Vivo, In Vitro] [Delivery Systems] [Human, Mouse] Matched Fields: vectorName : AAV.pU1a-SpCas9 PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV This sgRNA targets the Ai9 and related transgenes Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) Vector - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV Other Id: Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200 Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: vectorName : AAV.pU1a-SpCas9 H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) vectorSubtype : AAV Other Id: Anti-RFP (Rabbit) Polyclonal Antibody Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorSubtype : AAV Heaney Jason D Last Updated Date: 2021-03-30 AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Gao Validation (Gao, Guang-Ping )
SpCas9 Genome Editor - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorSubtype : AAV Show Experiments (2) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
ssAAV5-spCas9 Vector - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorSubtype : AAV Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
pAAV.pU1a-SpCas9 Vector - [In Vitro] [Delivery Systems] [Human] Matched Fields: vectorName : PH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
187. Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. Publication - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: description : In vitro and in vivo off-target editing from eVLPs was virtually undetected, an improvement over AAV Banskota S, Raguram A, Suh S, Du SW, Davis JR, Choi EH, Wang X, Nielsen SC, Newby GA, Randolph PB, Osborn MJ, Musunuru K, Palczewski K, Liu DR PII: S0092-8674(21)01484-7, PUBMED 35021064, PMC PMC8809250, DOI 10.1016/j.cell.2021.12.021 ABSTRACT: Methods to deliver gene editing agents in vivo as ribonucleoproteins could offer safety advantages over nucleic acid delivery approaches. We report the development and application of engineered DNA-free virus-like particles (eVLPs) that efficiently package and deliver base editor or Cas9 ribonucleoproteins. By engineering VLPs to overcome cargo packaging, release, and localization bottlenecks, we developed fourth-generation eVLPs that mediate efficient base editing in several primary mouse and h ... SCGE data tags... Projects Delivery Technologies for In Vivo Genome Editing
BCM_ssAAV5-Sp_sgB Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorSubtype : AAV This sgRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Ai9-SauSpyCas9 mouse Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorSubtype : AAV Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
scAAV5-Cre-GFP Vector - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorSubtype : AAV Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
ssAAV5-sgB.saCas9 Vector - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorSubtype : AAV Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
BCM_ssAAV5-Sa_sgB Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorSubtype : AAV This gRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
SaCas9 Genome Editor - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorSubtype : AAV Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
ssAAV5-sgA+sgB-U1A.GFP Vector - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorSubtype : AAV Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
BCM_ssAAV5-Sp_sgA Guide - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: vectorSubtype : AAV This sgRNA targets the Ai9 and related transgenes Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

195 results for AAV

Category	Name	Description	Source	View Associated...
Delivery System	AAV	See vector details		Show Experiments (9) Cre Recombinase dose escalation study in Ai9 mice AAV Tropism project AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids. Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Delivery System	AAV+Focused Ultrasound	See vector details	Leong Lab	Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Experiment	AAV Tropism project	Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging		Show Project SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice
Protocol	Conklin_Fast-Seq AAV Protocol	Published procedure for AAV composition measurement using fast-seq. Maynard et al. Fast-Seq: A Simple Method for Rapid and Inexpensive Validation of Packaged Single-Stranded Adeno-Associated Viral Genomes in Academic Settings. Hum Gene Ther Methods . 2019 Dec;30(6):195-205. doi: 10.1089/hgtb.2019.110.
Protocol	Heaney-SATC_Gao-Validation_Intratracheal Delivery of AAV in Mice	Procedure for Intratracheal (IT) delivery of AAV in mouse lung.		Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Experiment	AAV tropism in kidney organoids cultured under flow	Human kidney organoids generated from human ES and iPS cells are used to evaluate tropism of AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiation day 21 to 28. Four culture conditions were tested: U-well suspension culture, static culture on gelbrin, low flow on a chip coated with gelbrin, and high flow on a chip coated with gelbrin. Immunohistochemistry was performed to visualize transduced cells with staining for podocytes (PODXL) and proximal tubules (LTL). AAV2/2 shows the highest transduction efficiency among three serotypes evaluated, and the GFP expression is highest in the static condition.		Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
Project	SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice			Show Experiments (1) AAV Tropism project
Experiment	AAV tropism in kidney organoids derived from human pluripotent stem cells.	Human kidney organoids generated from human ES and iPS cells are used to evaluate tropism of AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiaiton day 21 to 28. Immunohistochemistry is performed to visualize transduced cells with staining for podocytes (PODXL), proximal tubules (LTL), loops of Henle and distal nephrons (CDH1), interstitial stromal cells (PDGFRb), and endothelia (CD31). AAV2/2 shows the highest transduction efficiency among three serotypes evaluated, and the GFP expression is highest in proximal tubular cells.		Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
Project	Evolving High Potency AAV Vectors for Neuromuscular Genome Editing	Recombinant adeno-associated viruses (AAV) have emerged as safe and effective vectors for clinical gene therapy applications including systemic treatment of neuromuscular diseases such as Spinal Muscular Atrophy (SMA), Duchenne Muscular Dystrophy (DMD), and Giant Axonal Neuropathy (GAN) amongst others. However, genome editing in neuromuscular tissue, in particular, is challenging. The current proposal is on a comprehensive and innovative approach to evolve high potency AAV variants for systemic neuromuscular genome editing.		Show Experiments (7) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Experiment	[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.	Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues.		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Asokan Validation (Asokan, Aravind)
Publication	Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing.	Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attributes benchmarked against AAV serotype 9 as evidenced by robust reporter and therapeutic gene expression, Cre recombination and CRISPR genome editing in normal and diseased mouse models. Enhanced transduction efficiency of AAV.cc47 vectors is further corroborated in macaques and pigs, providing a strong rationale for potential clinical translation into human gene therapies. We envision that ccAAV vectors may not only improve predictive modeling in preclinical studies, but also clinical translatability by broadening the therapeutic window of AAV based gene therapies.
Experiment	On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver	On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10.		Show Project Delivery Technologies for In Vivo Genome Editing
Guide	AAVS1_site_04	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Guide	AAVS1_site_06	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Guide	AAVS1_site_01	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Guide	AAVS1_site_03	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Guide	AAVS1_site_08	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Guide	AAVS1_site_09	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Guide	AAVS1_site_13	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Guide	AAVS1_site_14	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Experiment	AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS	Human kidney orgnaoids generated from human ES and iPS cells are used to evaluate tropism of AAV2 that expresses eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiation day 22 to 23. Four culture conditions are tested: full flow on a chip, pulsed flow on a chip, no flow on a chip, U-well suspension culture. Flow cytometry is performed to quantify the transduction efficiency in LTL+ proximal tubules. U-well culture shows the highest transduction efficiency among those four conditions.		Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
Guide	AAVS1_site_02	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Guide	AAVS1_site_07	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Guide	AAVS1_site_10	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Guide	AAVS1_site_11	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Guide	AAVS1_site_12	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Guide	AAVS1_site_05	Targets AAVS1 safe harbor locus	lab IVT	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Vector	AAV2-SaCas9	AAV expressing S. aureus Cas9 under control of the CMV promoter	VectorBuilder	Show Experiments (1) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.
Vector	AAV9-Ai9-sgRNA2-CB-SaCas9	AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAV9-CMV-Cre	AAV serotype 9 delivering CMV Cre Recombinase	Asokan Lab	Show Experiments (1) Cre Recombinase dose escalation study in Ai9 mice
Vector	AAV9-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAVcc47-SaCas9-Ai9	AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter	Asokan Lab	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Vector	AAV.pU1a-SpCas9	Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS	Addgene Gao Lab	Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Vector	AAV9-Ai9-sgRNA1-CB-SaCas9	AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAVcc47_pTR_self comp 2xU6-Ai9 guides	AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Vector	AAVcc81-GFP	AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Vector	AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAV2/9CMVeGFP	CMV-eGFP	University of Iowa Viral Vector Core	Show Experiments (4) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.
Vector	AAV8-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAV9_pTR_self comp 2xU6-Ai9 guides	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Vector	AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAVrh10-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAV2/2CMVeGFP	CMV-eGFP	University of Iowa Viral Vector Core	Show Experiments (5) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.
Vector	AAV2/8CMVeGFP	CMV-eGFP	University of Iowa Viral Vector Core	Show Experiments (4) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.
Vector	AAV5-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAV7-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAV9-mCherry	AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Vector	AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAV6-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAV9-GFP	AAV2/9 self complementary vector expressing GFP driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Vector	AAVcc47-Ai9-sgRNA1-CB-SaCas9	AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAVcc47-Ai9-sgRNA1 + sgRNA2	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Vector	AAVcc47-Ai9-sgRNA2-CB-SaCas9	AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus	Asokan Lab	Show Experiments (1) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)
Vector	AAV4-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAV9-CMV-SaCas9	AAV serotype 9 delivering CMV driven SaCas9	Asokan Lab	Show Experiments (3) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Vector	AAVcc84-GFP	AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Vector	AAVrh8-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAV2-gRNA	AAV expressing two sgRNAs targeting human DMD under control of U6 promoters and mCherry under control of the CMV promoter; pAAV[2gRNA]-mCherry-U6>{SagRNA#1*}:{SagRNA#2}	VectorBuilder	Show Experiments (2) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Vector	AAVcc47-CMV-Cre	AAVcc47 delivering CMV Cre Recombinase	Asokan Lab	Show Experiments (1) Cre Recombinase dose escalation study in Ai9 mice
Vector	AAVcc47-mCherry	AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter	Asokan Lab	Show Experiments (1) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Vector	AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAV3b-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAV9-Ai9-sgRNA1 + sgRNA2	AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Vector	AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAVrh74-ZsGreen-Cre	AAV backbone with a bi-directional promoter driving zsGreen and Cre	Guangping Gao Lab	Show Experiments (1) AAV Tropism project
Vector	AAVcc47-Cre	AAV2/5 expressing Cre recombinase	Asokan Lab	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Vector	AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2	AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence	Deverman Lab	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Vector	AAVcc47-CMV-SaCas9	AAVcc47 delivering CMV driven SaCas9	Asokan Lab	Show Experiments (2) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)
Vector	AAV-Pcsk9			Show Experiments (1) On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Genome Editor	SpCas9	HA-SV40NLS-SpCas9-SV40NLS	Vector Encoded	Show Experiments (4) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway A novel human T cell platform to define biological adverse effects of genome editing Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Model System	CD4/CD8 Human Primary T cell	CD4/CD8 Human Primary T cell	Key Biologicals	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Experiment	A novel human T cell platform to define biological adverse effects of genome editing	110 guide RNAs and SpCas9 were transfected into human T-cells. Indel rates were measured by targeted amplicon deep sequencing.		Show Project A Novel Human T-Cell Platform to Define Biological Effects of Genome Editing
Delivery System	P3 Nucleofection Kit	Nuceleofection kit to be used with Lonza's nucleofection system.	Lonza #V4SP-3096	Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Protocol	Tsai_T Cell Transfection Protocol	Procedure for T cell transfection.		Show Experiments (1) A novel human T cell platform to define biological adverse effects of genome editing
Publication	CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity.	Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily scalable to the throughput needed to fully understand the principles that govern Cas9 specificity. Here we describe 'circularization for high-throughput analysis of nuclease genome-wide effects by sequencing' (CHANGE-seq), a scalable, automatable tagmentation-based method for measuring the genome-wide activity of Cas9 in vitro. We applied CHANGE-seq to 110 single guide RNA targets across 13 therapeutically relevant loci in human primary T cells and identified 201,934 off-target sites, enabling the training of a machine learning model to predict off-target activity. Comparing matched genome-wide off-target, chromatin modification and accessibility, and transcriptional data, we found that cellular off-target activity was two to four times more likely to occur near active promoters, enhancers and transcribed regions. Finally, CHANGE-seq analysis of six targets across eight individual genomes revealed that human single-nucleotide variation had significant effects on activity at ~15.2% of off-target sites analyzed. CHANGE-seq is a simplified, sensitive and scalable approach to understanding the specificity of genome editors.
Experiment	Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.	Human kidney organoids generated from human iPS cells are used to evaluate toxicity induced by AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 . KIM-1 levels were measured using Luminex (Bioplex 200).		Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
Vector	demo VV04-Cre	DEMO viral vector for demo purpose	Virus Company X
Model System	Human kidney organoid (ESC-derived)	Kidney organoid derived from human female H9 embryonic stem cells	Morizane lab	Show Experiments (1) Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids.
Antibody	RRID:AB_2336558	Lotus tetragonolobus lectin (LTL)		Show Experiments (4) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.
Antibody	RRID:AB_298118	Rat anti-e-cadherin monoclonal antibody		Show Experiments (1) AAV tropism in kidney organoids derived from human pluripotent stem cells.
Antibody	RRID:AB_2118010	Rabbit anti-Phospho-Histone H2A.X (Ser139)		Show Experiments (1) Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Genome Editor	SaCas9 (AAV-SaCas9)	SaCas9 delivered by AAV-SaCas9 vector	VectorBuilder	Show Experiments (2) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)	A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Antibody	RRID:AB_10563941	Polyclonal rabbit anti-RFP antibody
Experiment	Testing AAV5 for activation of tdTomato in mouse airway	AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation		Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Experiment	Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.	An AAV2 viral vector carrying SaCas9 and AAV2 vector expressing mCherry and carrying two gRNAs against the DMD gene were used in human kidney organoids to assess transgene delivery to nephron epithelia. Organoids were treated with both AAVs at MOI 10^5 for one week. Delivery of Cas9 and gRNA vectors to nephron cell types were evaluted by immunohistochemistry. Note: additional data not shown demonstrated mCherry and SaCas9 were not detectable in non-transduced cells.		Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.	A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Antibody	RRID:AB_354920	Goat anti-podocalyxin polyclonal antibody		Show Experiments (2) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow
Genome Editor	Cre recombinase	Cre recombinase delivered by AAV (see vector details)		Show Experiments (4) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Cre Recombinase dose escalation study in Ai9 mice Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Antibody	RRID:AB_307284	Mouse anti-CD31 monoclonal antibody		Show Experiments (1) AAV tropism in kidney organoids derived from human pluripotent stem cells.
Guide	DMD low gRNA-2	One of two low-off target gRNAs delivred by dual gRNA AAV vector AAV-gRNA	VectorBuilder	Show Experiments (2) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Model System	Ai9 mouse	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	The Jackson Laboratory	Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Antibody	RRID:AB_300798	Chicken anti-GFP polyclonal antibody		Show Experiments (3) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS
Experiment	Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)	A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Vector	demo VV05-Cre	DEMO viral vector for demo purpose	Virus Company X
Model System	Human kidney organoid (stem cell-derived)	Kidney organoid derived from human female H9 ES or BJFF iPS cells	Morizane lab	Show Experiments (4) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Experiment	Testing AAV5 for activation of tdTomato in HEK293T cells	AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence.		Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Project	Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System	This project aims to advance the NIH Somatic Cell Genome Editing Program’s objective to identify novel delivery technologies that enable genome editing in therapeutically relevant somatic cell populations. We will use proven virus engineering methods to develop new vehicles that can deliver genome editing machinery throughout the adult mammalian central nervous system. Accomplishing this objective would pave the road for applying gene editing, and gene therapy more broadly, to the study and treatment of neurological and psychiatric disorders.		Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Experiment	Cre Recombinase dose escalation study in Ai9 mice	A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Antibody		mouse anti-saCas9 monoclonal antibody		Show Experiments (1) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.
Antibody	RRID:AB_2750570	Mouse anti-meis1/2/3		Show Experiments (1) Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Antibody	RRID:AB_2116561	Goat anti-KIM1/HAVCR		Show Experiments (1) Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Antibody	RRID:AB_777165	Rabbit anti-PDGFRb monoclonal antibody		Show Experiments (1) AAV tropism in kidney organoids derived from human pluripotent stem cells.
Experiment	Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.	AAV2 that carries saCas9 and AAV2 carrying two gRNAs against DMD gene and mCherry were used in kidney organoids to assess toxicity compared to AAV2-GFP or mock transduced kidney organoids.		Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
Vector	demo VV03-Cre	DEMO viral vector for demo purpose	Virus Company X
Model System	Human kidney organoid (iPSC-derived)	Kidney organoid derived from human male BJFF iPS cells	Morizane lab	Show Experiments (2) AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.
Antibody		mouse anti-saCas9 monoclonal antibody		Show Experiments (1) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.
Antibody	RRID:AB_2336558	Lotus tetragonolobus lectin (LTL)		Show Experiments (1) Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Model System	C57BL/6 mouse (Asokan study)		Unspecified	Show Experiments (2) Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.
Experiment	Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.	C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Genome Editor	SaCas9-Lagor		William Lagor, Baylor College Of Medicine	Show Experiments (4) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.
Genome Editor	SauCas9			Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Experiment	FUS (focused ultrasound) array validation in Ai9 mice	9.3 week-old Ai9 mice (4 male and 4 female) were administered Ai9-targeting SaCas9 AAV9 vector through intravenous adminsitration (2E12 vg/mouse) and left hemisphere was targeted by FUS (focused ultrasound) array for BBB (blood brain barrier) opening		Show Project Focused Ultrasound-mediated Delivery of Gene-editing Elements to the Brain for Neurodegenerative Disorders
Antibody	RRID:AB_2762834	Alexa fluor 555, Donkey anti-rabbit
Antibody	RRID:AB_141607	Alexa fluor 488, Donkey anti-mouse
Protocol	Deverman_Comprehensive Methods	Procedure for plasmid cloning, editing evaluation in fibroblast, AAV production and administration, tissue processing and IHC.		Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Genome Editor	SaCas9		Leong Lab	Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Guide	Sa_Ai9_L	This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016)		Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Guide	Sa_Ai9_R	This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016)		Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Vector	Ai9LR21-SaCas9	AAV9 encoding S. aureus Cas9 and two guide RNAs with modified scaffolds	Leong Lab	Show Experiments (1) FUS (focused ultrasound) array validation in Ai9 mice
Antibody	RRID:AB_10711040	Mouse monoclonal [1B7] to NeuN - Neuronal Marker
Protocol	Deverman_AAV Production and Administration Protocol	Published procedures for AAV production, delivery, and tissue imaging. Challis et al. Systemic AAV vectors for widespread and targeted gene delivery in rodents. Nat Protoc. 2019 Feb;14(2):379-414. doi: 10.1038/s41596-018-0097-3.		Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	Ai9 SaCas9 Guide A	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Guide	Ai9 SaCas9 Guide B	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.
Experiment	[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain	Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Deverman Validation (Deverman, Benjamin)
Experiment	Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.	C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Guide	DMD low gRNA-1	One of two low-off target gRNAs delivred by dual gRNA AAV vector pAAV[2gRNA]-mCherry-U6>{SagRNA#1*}:{SagRNA#2}	VectorBuilder	Show Experiments (1) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.
Experiment	Testing gRNA sequence and gRNA scaffold modified in Ai9 mice.	3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later.		Show Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System
Vector	BI28:AAV-GFAP-SaCas9-WPRE3-pA	Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter	Deverman Lab	Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Experiment	Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids.	Human kidney organoids generated from human ES are used to evaluate toxicity and inflammation induced by AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 . MCP-1 and KIM-1 levels were measured using Luminex (Bioplex 200).		Show Project Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing
Vector	demo VV01-Cre	DEMO viral vector for demo purpose	Virus Company X
Vector	demo VV02-Cre	DEMO viral vector for demo purpose	Virus Company X
Antibody	RRID:AB_2722769	Chicken anti-mCherry antibody		Show Experiments (1) Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.
Antibody	RRID:AB_307284	Mouse anti-CD31 antibody		Show Experiments (1) Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Experiment	Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)	A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart.		Show Project Evolving High Potency AAV Vectors for Neuromuscular Genome Editing
Vector	BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2	Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds	Deverman Lab	Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Guide	SaLoxP1-modified	This gRNA targets the mTmG, Ai9 and related transgenes at two sites	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Experiment	Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells	AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types.		Show Project Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases
Genome Editor	TadA-8e V106W	Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W)	Chaikof Lab	Show Experiments (2) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Genome Editor	SaCas9			Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Protocol	Deverman_Area Based Quantification of Editing Efficiency Protocol	Procedure for non-IHC based image quantification of editing.		Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Model System	C57BL/6J mouse	C57BL/6J WT mouse	The Jackson Laboratory	Show Experiments (3) Testing new LNPs (lipid nanoparticles) for delivery of Fluc mRNA in adult mice Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Guide	L3-modifed	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Delivery System	eVLP	engineered virus like particles	Liu Lab	Show Experiments (3) Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver Independent validation of Chaikof delivery platform using virus-like particle (VLP) delivery to the mouse liver
Experiment	Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro	Reporter transgene activation by SaCas9 gRNA target and modified scaffold sequences by transient transfection in immortalized Ai9 mouse fibroblasts		Show Project Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System
Guide	L2-unmodified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	R1-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	R1-unmodified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	L3-unmodified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	R2-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (2) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	R2-unmodified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	L1-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (3) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Guide	L1-unmodified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	L2-modified	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (2) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Guide	SaLoxP2-unmodified	This gRNA targets the mTmG, Ai9 and related transgenes at two sites	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Guide	SaLoxP1-unmodified	This gRNA targets the mTmG, Ai9 and related transgenes at two sites	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Protocol	Chaikof-Associated Protocol 2_Off-target editing AND Primers for sequencing analysis	This protocol describes in vivo adminstration and subsequent analysis of off-target editing in the liver.		Show Experiments (1) On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver
Project	Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing	The proposed work will take advantage of the state-of-the-art technology of kidney organoids that we recently generated from human pluripotent stem cells (hPSCs) and further advance this technology toward the goal of establishing kidney tissue platforms for assessment of somatic genome editing. We will optimize kidney organoid generation and AAV transduction for assessment of adverse effects of CRISR genome editing. Further, we will incorporate the 3D-printed vascular system into kidney organoids to simulate in vivo pharmacokinetics and pharmacodynamics on chips.		Show Experiments (7) AAV tropism in kidney organoids derived from human pluripotent stem cells. AAV tropism in kidney organoids cultured under flow AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids. Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.
Model System	Ai9 mouse (BCM)	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	Baylor College of Medicine	Show Experiments (2) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Model System	Ai9 mouse immortalized fibroblasts	Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice		Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Antibody		Anti-RFP (RABBIT) Antibody		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
Antibody		Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Protocol	Heaney_SATC Tissue Processing, Imaging and Analysis	Procedure for tissue preparation, imaging and analysis.		Show Experiments (4) Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain
Guide	sgAi9R	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Guide	SaLoxP2-modified	This gRNA targets the mTmG, Ai9 and related transgenes at two sites	Vector encoded	Show Experiments (1) Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro
Antibody		Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody		GFP (D5.1) XP Rabbit mAb antibody		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway
Vector	pH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)	AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP	Addgene Gao Lab	Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Model System	HEK-293T with Ai9 transient reporter assay	HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.		Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Delivery System	Lipofectamine 3000	Lipid nanoparticle	Thermo Fisher Scientific	Show Experiments (2) Testing newly discovered Biggie Phage editors in human cells Testing AAV5 for activation of tdTomato in HEK293T cells
Guide	sgAi9L	This sgRNA targets the Ai9 and related transgenes	IDT	Show Experiments (3) Testing AAV5 for activation of tdTomato in HEK293T cells Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Vector	H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)	AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP	Addgene Gao Lab	Show Experiments (2) Testing AAV5 for activation of tdTomato in mouse airway Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody		Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Antibody		Anti-RFP (Rabbit) Polyclonal Antibody		Show Experiments (1) Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells
Experiment	[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice	AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway		Show Project BCM-Rice Resource for the Analysis of Somatic Gene Editing in Mice - Gao Validation (Gao, Guang-Ping )
Genome Editor	SpCas9		IDT	Show Experiments (2) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides
Vector	ssAAV5-spCas9		Gao Lab	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Vector	pAAV.pU1a-SpCas9	Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS	Addgene Gao Lab	Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Publication	Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins.	Methods to deliver gene editing agents in vivo as ribonucleoproteins could offer safety advantages over nucleic acid delivery approaches. We report the development and application of engineered DNA-free virus-like particles (eVLPs) that efficiently package and deliver base editor or Cas9 ribonucleoproteins. By engineering VLPs to overcome cargo packaging, release, and localization bottlenecks, we developed fourth-generation eVLPs that mediate efficient base editing in several primary mouse and human cell types. Using different glycoproteins in eVLPs alters their cellular tropism. Single injections of eVLPs into mice support therapeutic levels of base editing in multiple tissues, reducing serum Pcsk9 levels 78% following 63% liver editing, and partially restoring visual function in a mouse model of genetic blindness. In vitro and in vivo off-target editing from eVLPs was virtually undetected, an improvement over AAV or plasmid delivery. These results establish eVLPs as promising vehicles for therapeutic macromolecule delivery that combine key advantages of both viral and nonviral delivery.
Guide	BCM_ssAAV5-Sp_sgB	This sgRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Model System	Ai9-SauSpyCas9 mouse	Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.	Baylor College of Medicine	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Vector	scAAV5-Cre-GFP		Gao Lab	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Vector	ssAAV5-sgB.saCas9		Gao Lab	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Guide	BCM_ssAAV5-Sa_sgB	This gRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Genome Editor	SaCas9		Vector Encoded (ssaav5-sga+sgb-u1a.gfp)	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Vector	ssAAV5-sgA+sgB-U1A.GFP		Gao Lab	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Guide	BCM_ssAAV5-Sp_sgA	This sgRNA targets the Ai9 and related transgenes	Vector encoded	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice

Contact SCGE

195 results for AAV

Select Category

OR Filter By ...

195 results for AAV

[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.

11. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing.

83. CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity.

RRID:AB_2336558

RRID:AB_298118

RRID:AB_2118010

RRID:AB_10563941

RRID:AB_354920

RRID:AB_307284

RRID:AB_300798

RRID:AB_2750570

RRID:AB_2116561

RRID:AB_777165

RRID:AB_2336558

RRID:AB_2762834

RRID:AB_141607

RRID:AB_10711040

[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain

RRID:AB_2722769

RRID:AB_307284