205 results for AAV
205 results for AAV
AAVDelivery System - [In Vivo, In Vitro] [Human, Mouse]Show Experiments (10)
|
AAV Tropism projectExperiment - [In Vivo] [AAV tropism] [Mouse] |
Conklin_Fast-Seq AAV ProtocolProtocol |
Heaney-SATC_Gao-Validation_Intratracheal Delivery of AAV in MiceProtocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse] |
AAV tropism in kidney organoids cultured under flowExperiment - [In Vitro] [Biological Effects] [Human]
|
Evolving High Potency AAV Vectors for Neuromuscular Genome EditingProject - [In Vivo] [Delivery Systems]
Show Experiments (9)
|
AAV tropism in kidney organoids derived from human pluripotent stem cells.Experiment - [In Vitro] [Biological Effects] [Human]
|
SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in MiceProject - [In Vivo] [AAV tropism]Show Experiments (1) |
10. Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing.Publication - [In Vivo] [Delivery Systems, DCC, AAV tropism, Animal Reporter and Testing Center] [Mouse]PII: 10.1038/s41467-022-33745-4, PUBMED 36210364, PMC PMC9548504, DOI 10.1038/s41467-022-33745-4 ABSTRACT: Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attrib ... SCGE data tags...
|
[Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing.Experiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liverExperiment - [In Vivo] [Delivery Systems] [Mouse]
Show Project |
AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACSExperiment - [In Vitro] [Biological Effects] [Human]
|
AAV2-gRNAVector - [In Vitro] [Human] |
AAV5-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAV8-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAVcc47-Ai9-sgRNA1 + sgRNA2Vector - [In Vivo] [Mouse] |
AAVcc47-CMV-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAVcc84-GFPVector - [In Vivo] [Mouse] |
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1Vector - [In Vitro] [Mouse] |
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1Vector - [In Vitro] [Mouse] |
AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2Vector - [In Vitro] [Mouse] |
AAV4-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAV6-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAV9-CMV-SaCas9Vector - [In Vivo] [Mouse]Show Experiments (3)
|
AAV9-GFPVector - [In Vivo] [Mouse] |
AAV9-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAVcc47-Ai9-sgRNA2-CB-SaCas9Vector - [In Vivo] [Mouse] |
AAVcc47-mCherryVector - [In Vivo] [Mouse] |
AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1Vector - [In Vitro] [Mouse] |
AAVrh74-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAV2-SaCas9Vector - [In Vitro] [Human]Show Experiments (1) |
AAV9-CMV-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAV9-mCherryVector - [In Vivo] [Mouse] |
AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3Vector - [In Vitro] [Mouse] |
AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1Vector - [In Vitro] [Mouse] |
AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2Vector - [In Vitro] [Mouse] |
AAV.pU1a-SpCas9Vector - [In Vivo] [Mouse] |
AAVrh8-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAV2/8CMVeGFPVector - [In Vitro] [Human]Show Experiments (4)
|
AAV9-Ai9-sgRNA1 + sgRNA2Vector - [In Vivo] [Mouse] |
AAV9-Ai9-sgRNA2-CB-SaCas9Vector - [In Vivo] [Mouse] |
AAVcc47-Ai9-sgRNA1-CB-SaCas9Vector - [In Vivo] [Mouse] |
AAVcc47-SaCas9/guide DMDVector - [In Vivo] |
AAVcc81-GFPVector - [In Vivo] [Mouse] |
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2Vector - [In Vitro] [Mouse] |
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1Vector - [In Vitro] [Mouse] |
AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2Vector - [In Vitro] [Mouse] |
AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1Vector - [In Vitro] [Mouse] |
AAV-Pcsk9Vector - [In Vivo] [Mouse] |
AAV3b-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAV9-Ai9-sgRNA1-CB-SaCas9Vector - [In Vivo] [Mouse] |
AAV9-SaCas9/guide DMDVector - [In Vivo] |
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2Vector - [In Vitro] [Mouse] |
AAV2/9CMVeGFPVector - [In Vitro] [Human]Show Experiments (4)
|
AAVcc47_pTR_self comp 2xU6-Ai9 guidesVector - [In Vivo] [Mouse] |
AAV2/2CMVeGFPVector - [In Vitro] [Human]Show Experiments (5)
|
AAVcc47-SaCas9-Ai9Vector - [In Vivo] [Mouse] |
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3Vector - [In Vitro] [Mouse] |
AAV7-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
AAV9_pTR_self comp 2xU6-Ai9 guidesVector - [In Vivo] [Mouse] |
AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2Vector - [In Vitro] [Mouse] |
AAVrh10-ZsGreen-CreVector - [In Vivo] [Mouse]Show Experiments (1) |
DMD low gRNA-2Guide - [In Vitro] [Human] |
Cre recombinaseGenome Editor - [In Vivo, In Vitro] [Mouse]Show Experiments (4)
|
Deverman_AAV Production and Administration ProtocolProtocol - [In Vitro] [Delivery Systems] [Mouse] |
BI28:AAV-GFAP-SaCas9-WPRE3-pAVector - [In Vivo] [Mouse] |
Deverman_Comprehensive MethodsProtocol - [In Vivo, In Vitro] [Delivery Systems] [Mouse] |
CD4/CD8 Human Primary T cellModel System - [In Vitro] [Human]Show Experiments (1) |
Tsai_T Cell Transfection ProtocolProtocol - [In Vitro] [Biological Effects] [Human]Show Experiments (1) |
A novel human T cell platform to define biological adverse effects of genome editingExperiment - [In Vitro] [Biological Effects] [Human]
|
P3 Nucleofection KitDelivery System - [In Vitro] [Human]Show Experiments (1) |
BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2Vector - [In Vivo] [Mouse] |
Ai9 mouseModel System - [In Vivo] [Mouse]Show Experiments (11)
|
Testing gRNA sequence and gRNA scaffold modified in Ai9 mice.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
94. CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity.Publication - [In Vitro] [Biological Effects] [Human]PII: 10.1038/s41587-020-0555-7, PUBMED 32541958, PMC PMC7652380, MID NIHMS1591991, DOI 10.1038/s41587-020-0555-7 ABSTRACT: Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily scalable to the throughput needed to fully understand the principles that govern Cas9 specificity. Here we describe 'circularization for high-throughput analysis of nuclease genome-wide effects by sequencing' (CHANGE-seq), a scalable, automatable tagmentation-based method for measuring the genome-wide activity of Cas9 in vitro. We applied CHANGE-seq to 110 single guide RNA targets across 13 thera ... SCGE data tags...
|
Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intramuscular administration to rhesus macaquesExperiment - [In Vivo] [Delivery Systems]
|
Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids.Experiment - [In Vitro] [Biological Effects] [Human]
|
|
Other Id:
Ab9498 (Abcam)
B-1325-2 (Vector Labs)
Ab13970 (Abcam)
AF1658 (R&D Systems)
Ab11512 (Abcam)
Ab32570 (Abcam)
Rat anti-e-cadherin monoclonal antibody Show Experiments (1) |
|
Other Id:
Ab9498 (Abcam)
B-1325-2 (Vector Labs)
Ab13970 (Abcam)
AF1658 (R&D Systems)
Ab11512 (Abcam)
Ab32570 (Abcam)
Mouse anti-CD31 monoclonal antibody Show Experiments (1) |
|
Other Id:
Cell Signaling Technology Cat# 2577
Vector Laboratories Cat# B-1325
Active Motif Cat# 39795
Abcam Cat# ab9498
R and D Systems Cat# AF1750
Lotus tetragonolobus lectin (LTL) |
|
Other Id:
Cell Signaling Technology Cat# 2577
Vector Laboratories Cat# B-1325
Active Motif Cat# 39795
Abcam Cat# ab9498
R and D Systems Cat# AF1750
Goat anti-KIM1/HAVCR |
Human kidney organoid (ESC-derived)Model System - [In Vitro] [Human] |
DMD low gRNA-1Guide - [In Vitro] [Human]Show Experiments (1) |
|
Other Id:
Ab9498 (Abcam)
B-1325-2 (Vector Labs)
Ab13970 (Abcam)
AF1658 (R&D Systems)
Ab11512 (Abcam)
Ab32570 (Abcam)
Rabbit anti-PDGFRb monoclonal antibody Show Experiments (1) |
|
Other Id:
Cell Signaling Technology Cat# 2577
Vector Laboratories Cat# B-1325
Active Motif Cat# 39795
Abcam Cat# ab9498
R and D Systems Cat# AF1750
Rabbit anti-Phospho-Histone H2A.X (Ser139) |
Human kidney organoid (stem cell-derived)Model System - [In Vitro] [Human]Show Experiments (4)
|
|
Other Id:
Ab9498 (Abcam)
B-1325-2 (Vector Labs)
Ab13970 (Abcam)
AF1658 (R&D Systems)
Ab11512 (Abcam)
Ab32570 (Abcam)
Goat anti-podocalyxin polyclonal antibody |
Antibody - [In Vitro] [Human]mouse anti-saCas9 monoclonal antibody Show Experiments (1) |
Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids.Experiment - [In Vitro] [Biological Effects] [Human]
|
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
kidney organoidModel System - [In Vitro] [Human]Show Experiments (1) |
Cre Recombinase dose escalation study in Ai9 miceExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
Human kidney organoid (iPSC-derived)Model System - [In Vitro] [Human] |
|
Other Id:
Ab9498 (Abcam)
Ab205402 (Abcam)
B-1325-2 (Vector Labs)
Ab13970 (Abcam)
AF1658 (R&D Systems)
Ab11512 (Abcam)
Ab32570 (Abcam)
A01951 (GenScript)
Lotus tetragonolobus lectin (LTL) Show Experiments (4) |
|
Other Id:
Cell Signaling Technology Cat# 2577
Vector Laboratories Cat# B-1325
Active Motif Cat# 39795
Abcam Cat# ab9498
R and D Systems Cat# AF1750
Mouse anti-meis1/2/3 |
|
Other Id:
Cell Signaling Technology Cat# 2577
Vector Laboratories Cat# B-1325
Active Motif Cat# 39795
Abcam Cat# ab9498
R and D Systems Cat# AF1750
Mouse anti-CD31 antibody |
Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids.Experiment - [In Vitro] [Biological Effects] [Human]
|
|
Other Id:
Ab9498 (Abcam)
B-1325-2 (Vector Labs)
Ab13970 (Abcam)
AF1658 (R&D Systems)
Ab11512 (Abcam)
Ab32570 (Abcam)
Chicken anti-GFP polyclonal antibody |
|
Other Id:
Ab205402 (Abcam)
B-1325-2 (Vector Labs)
A01951 (GenScript)
Chicken anti-mCherry antibody Show Experiments (1) |
Antibody - [In Vitro] [Human]mouse anti-saCas9 monoclonal antibody Show Experiments (1) |
Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intravenous administration to rhesus macaquesExperiment - [In Vivo] [Delivery Systems]
|
Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids.Experiment - [In Vitro] [Biological Effects] [Human]
|
Alt-R™ S.p. HiFi Cas9 Nuclease V3Genome Editor - [In Vitro] [Human]Show Experiments (1) |
CRISPRMAXDelivery System - [In Vitro] [Human]Show Experiments (1) |
SaCas9Genome Editor - [In Vivo] [Mouse]Show Experiments (1) |
Sa_Ai9_LGuide - [In Vivo] [Mouse]Show Experiments (1) |
|
Other Id:
Invitrogen, R10367
Polyclonal rabbit anti-RFP antibody Show Experiments (1) |
Sa_Ai9_RGuide - [In Vivo] [Mouse]Show Experiments (1) |
136. Focused ultrasound-mediated brain genome editing.Publication - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse]PUBMED: 37579143, PMC PMC10450663, DOI 10.1073/pnas.2302910120 ABSTRACT: Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to ... SCGE data tags...
|
FUS (focused ultrasound) array validation in Ai9 miceExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
Ai9LR21-SaCas9Vector - [In Vivo] [Mouse]Show Experiments (1) |
GFP-cRNAGuide - [In Vitro] [Human]Show Experiments (1) |
Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter)Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
TLR-2 mouseModel System - [In Vivo] [Mouse]Show Experiments (1) |
Testing AAV5 for activation of tdTomato in mouse airwayExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
Analysis of editing outcomes and adverse events in human kidney organoidsExperiment - [In Vitro] [Biological Effects] [Human]
|
Testing AAV5 for activation of tdTomato in HEK293T cellsExperiment - [In Vitro] [Delivery Systems] [Human]
|
Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cellsExperiment - [In Vivo] [Delivery Systems] [Mouse]
|
[Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brainExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice.Experiment - [In Vivo] [Delivery Systems] [Mouse]
|
SaCas9-LagorGenome Editor - [In Vivo] [Mouse]Show Experiments (4)
|
Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous SystemProject - [In Vivo, In Vitro] [Delivery Systems]
|
Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editingProject - [In Vitro] [Biological Effects]
Show Experiments (7)
|
SaCas9Genome Editor - [In Vivo, In Vitro] [Mouse]Show Experiments (3) |
SaLoxP1-modifiedGuide - [In Vitro] [Mouse] |
SaLoxP2-unmodifiedGuide - [In Vitro] [Mouse] |
L1-modifiedGuide - [In Vivo, In Vitro] [Mouse]Show Experiments (3) |
SauCas9Genome Editor - [In Vivo] [Mouse] |
Ai9 mouse immortalized fibroblastsModel System - [In Vitro] [Mouse] |
Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitroExperiment - [In Vitro] [Delivery Systems] [Mouse]
|
SaLoxP1-unmodifiedGuide - [In Vitro] [Mouse] |
SaLoxP2-modifiedGuide - [In Vitro] [Mouse] |
Deverman_Area Based Quantification of Editing Efficiency ProtocolProtocol - [In Vivo, In Vitro] [Delivery Systems] [Mouse] |
Ai9 mouse (BCM)Model System - [In Vivo] [Mouse] |
Heaney_SATC Tissue Processing, Imaging and AnalysisProtocol - [In Vivo] [Animal Reporter and Testing Center] [Mouse]Show Experiments (4)
|
Antibody - [In Vivo] [Mouse]Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300 Show Experiments (1) |
Chaikof-Associated Protocol 2_Off-target editing AND Primers for sequencing analysisProtocol - [In Vivo] [Delivery Systems] [Mouse] |
H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)Vector - [In Vivo] [Mouse] |
Antibody - [In Vivo] [Mouse]GFP (D5.1) XP Rabbit mAb antibody Show Experiments (1) |
Antibody - [In Vivo] [Mouse]Anti-RFP (RABBIT) Antibody Show Experiments (1) |
Antibody - [In Vivo] [Mouse]Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200 Show Experiments (1) |
HEK-293T with Ai9 transient reporter assayModel System - [In Vitro] [Human]Show Experiments (1) |
Antibody - [In Vivo] [Mouse]Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000 Show Experiments (1) |
Antibody - [In Vivo] [Mouse]Anti-RFP (Rabbit) Polyclonal Antibody Show Experiments (1) |
TadA-8e V106WGenome Editor - [In Vivo] [Mouse] |
eVLPDelivery System - [In Vivo] [Mouse]Show Experiments (3)
|
pH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1)Vector - [In Vitro] [Human]Show Experiments (1) |
Cre recombinaseGenome Editor - [In Vitro] [Human]Show Experiments (1) |
194. Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins.Publication - [In Vivo] [Delivery Systems] [Mouse]PII: S0092-8674(21)01484-7, PUBMED 35021064, PMC PMC8809250, DOI 10.1016/j.cell.2021.12.021 ABSTRACT: Methods to deliver gene editing agents in vivo as ribonucleoproteins could offer safety advantages over nucleic acid delivery approaches. We report the development and application of engineered DNA-free virus-like particles (eVLPs) that efficiently package and deliver base editor or Cas9 ribonucleoproteins. By engineering VLPs to overcome cargo packaging, release, and localization bottlenecks, we developed fourth-generation eVLPs that mediate efficient base editing in several primary mouse and h ... SCGE data tags...
|
scAAV5-Cre-GFPVector - [In Vivo] [Mouse] |
[Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 miceExperiment - [In Vivo] [Animal Reporter and Testing Center] [Mouse]
|
ssAAV5-sgA+sgB-U1A.GFPVector - [In Vivo] [Mouse] |
ssAAV5-sgB.saCas9Vector - [In Vivo] [Mouse] |
SaCas9Genome Editor - [In Vivo] [Mouse] |
ssAAV5-spCas9Vector - [In Vivo] [Mouse] |
Ai9-SauSpyCas9 mouseModel System - [In Vivo] [Mouse] |
SpCas9Genome Editor - [In Vivo] [Mouse] |
205 results for AAV
| Category | Name | Description | Source | View Associated... |
|---|---|---|---|---|
| Delivery System | AAV | See vector details |
Show Experiments (10)
|
|
| Delivery System | AAV+Focused Ultrasound | See vector details | Leong Lab |
Show Experiments (1) |
| Experiment | AAV Tropism project | Ten AAV serotypes delivering Cre recombinase were tested by intravenous delivery into Ai9 mice and chacterized for biodistribution across 20 tissues by quantitative PCR and imaging | ||
| Protocol | Conklin_Fast-Seq AAV Protocol | Published procedure for AAV composition measurement using fast-seq. Maynard et al. Fast-Seq: A Simple Method for Rapid and Inexpensive Validation of Packaged Single-Stranded Adeno-Associated Viral Genomes in Academic Settings. Hum Gene Ther Methods . 2019 Dec;30(6):195-205. doi: 10.1089/hgtb.2019.110. | ||
| Protocol | Heaney-SATC_Gao-Validation_Intratracheal Delivery of AAV in Mice | Procedure for Intratracheal (IT) delivery of AAV in mouse lung. | ||
| Experiment | AAV tropism in kidney organoids cultured under flow | Human kidney organoids generated from human ES and iPS cells are used to evaluate tropism of AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiation day 21 to 28. Four culture conditions were tested: U-well suspension culture, static culture on gelbrin, low flow on a chip coated with gelbrin, and high flow on a chip coated with gelbrin. Immunohistochemistry was performed to visualize transduced cells with staining for podocytes (PODXL) and proximal tubules (LTL). AAV2/2 shows the highest transduction efficiency among three serotypes evaluated, and the GFP expression is highest in the static condition. | ||
| Project | Evolving High Potency AAV Vectors for Neuromuscular Genome Editing | Recombinant adeno-associated viruses (AAV) have emerged as safe and effective vectors for clinical gene therapy applications including systemic treatment of neuromuscular diseases such as Spinal Muscular Atrophy (SMA), Duchenne Muscular Dystrophy (DMD), and Giant Axonal Neuropathy (GAN) amongst others. However, genome editing in neuromuscular tissue, in particular, is challenging. The current proposal is on a comprehensive and innovative approach to evolve high potency AAV variants for systemic neuromuscular genome editing. |
Show Experiments (9)
|
|
| Experiment | AAV tropism in kidney organoids derived from human pluripotent stem cells. | Human kidney organoids generated from human ES and iPS cells are used to evaluate tropism of AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiaiton day 21 to 28. Immunohistochemistry is performed to visualize transduced cells with staining for podocytes (PODXL), proximal tubules (LTL), loops of Henle and distal nephrons (CDH1), interstitial stromal cells (PDGFRb), and endothelia (CD31). AAV2/2 shows the highest transduction efficiency among three serotypes evaluated, and the GFP expression is highest in proximal tubular cells. | ||
| Project | SCGE AAV Tropism Supplement: Evaluation Across Multiple Tissues in Mice |
Show Experiments (1) |
||
| Publication | Cross-species evolution of a highly potent AAV variant for therapeutic gene transfer and genome editing. | Recombinant adeno-associated viral (AAV) vectors are a promising gene delivery platform, but ongoing clinical trials continue to highlight a relatively narrow therapeutic window. Effective clinical translation is confounded, at least in part, by differences in AAV biology across animal species. Here, we tackle this challenge by sequentially evolving AAV capsid libraries in mice, pigs and macaques. We discover a highly potent, cross-species compatible variant (AAV.cc47) that shows improved attributes benchmarked against AAV serotype 9 as evidenced by robust reporter and therapeutic gene expression, Cre recombination and CRISPR genome editing in normal and diseased mouse models. Enhanced transduction efficiency of AAV.cc47 vectors is further corroborated in macaques and pigs, providing a strong rationale for potential clinical translation into human gene therapies. We envision that ccAAV vectors may not only improve predictive modeling in preclinical studies, but also clinical translatability by broadening the therapeutic window of AAV based gene therapies. | ||
| Experiment | [Validation] Independent validation for Asokan Delivery Team: Evolving High Potency AAV Vectors for Neuromuscular Genome Editing. | Quantification of CRISPR/Cas editing in liver and heart following custom AAV-mediated delivery. Detection of editing in non-target tissues. | ||
| Experiment | On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver | On-target editing compared to off-target editing at 14 CIRCLE seq nominated sites in livers of an adenine base editor delivered by engineered virus-like particles (BE-eVLPs). Treated mice vs. untreated vs. AAV was assessed one week after systemic administration of BE-eVLPs or AAV-Pcsk9 to C57BL/6 mice. DNA sequencing reads containing A-T to G-C mutations within protospacer positions 4-10. |
Show Project |
|
| Guide | AAVS1_site_01 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Guide | AAVS1_site_05 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Guide | AAVS1_site_07 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Guide | AAVS1_site_02 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Guide | AAVS1_site_04 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Guide | AAVS1_site_09 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Experiment | AAV2/2 transduction efficiencies in kidney organoids cultured under flow determined by FACS | Human kidney orgnaoids generated from human ES and iPS cells are used to evaluate tropism of AAV2 that expresses eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 from differentiation day 22 to 23. Four culture conditions are tested: full flow on a chip, pulsed flow on a chip, no flow on a chip, U-well suspension culture. Flow cytometry is performed to quantify the transduction efficiency in LTL+ proximal tubules. U-well culture shows the highest transduction efficiency among those four conditions. | ||
| Guide | AAVS1_site_08 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Guide | AAVS1_site_12 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Guide | AAVS1_site_03 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Guide | AAVS1_site_06 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Guide | AAVS1_site_14 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Guide | AAVS1_site_13 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Guide | AAVS1_site_10 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Guide | AAVS1_site_11 | Targets AAVS1 safe harbor locus | Lab IVT |
Show Experiments (1) |
| Vector | AAV2-gRNA | AAV expressing two sgRNAs targeting human DMD under control of U6 promoters and mCherry under control of the CMV promoter; pAAV[2gRNA]-mCherry-U6>{SagRNA#1*}:{SagRNA#2} | VectorBuilder | |
| Vector | AAV5-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAV8-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAVcc47-Ai9-sgRNA1 + sgRNA2 | AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAVcc47-CMV-Cre | AAVcc47 delivering CMV Cre Recombinase | Asokan Lab |
Show Experiments (1) |
| Vector | AAVcc84-GFP | AAV2/9 self complementary vector with capsid variant cc84 expressing GFP driven by CBh promoter | Asokan Lab | |
| Vector | AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L1 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA | Deverman Lab | |
| Vector | AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP1 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA | Deverman Lab | |
| Vector | AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP2 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence | Deverman Lab | |
| Vector | AAV4-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAV6-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAV9-CMV-SaCas9 | AAV serotype 9 delivering CMV driven SaCas9 | Asokan Lab |
Show Experiments (3)
|
| Vector | AAV9-GFP | AAV2/9 self complementary vector expressing GFP driven by CBh promoter | Asokan Lab | |
| Vector | AAV9-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAVcc47-Ai9-sgRNA2-CB-SaCas9 | AAVcc47 delivering sgRNA 2 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAVcc47-mCherry | AAV2/9 self complementary vector with capsid variant cc47 expressing Mcherry driven by CBh promoter | Asokan Lab | |
| Vector | AAV-CMV-SaCas9-U6-modified scaffold-Sa-L1 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence | Deverman Lab | |
| Vector | AAVrh74-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAV2-SaCas9 | AAV expressing S. aureus Cas9 under control of the CMV promoter | VectorBuilder |
Show Experiments (1) |
| Vector | AAV9-CMV-Cre | AAV serotype 9 delivering CMV Cre Recombinase | Asokan Lab |
Show Experiments (1) |
| Vector | AAV9-mCherry | AAV2/9 self complementary vector expressing Mcherry driven by CBh promoter | Asokan Lab | |
| Vector | AAV-CMV-SaCas9-U6-modified scaffold-Sa-L3 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence | Deverman Lab | |
| Vector | AAV-CMV-SaCas9-U6-modified scaffold-Sa-LoxP1 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence | Deverman Lab | |
| Vector | AAV-CMV-SaCas9-U6-modified scaffold-Sa-R2 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence | Deverman Lab | |
| Vector | AAV.pU1a-SpCas9 | Expresses codon-optimized SpCas9 in mammalian cells. HA-SV40NLS-SpCas9-SV40NLS | Addgene | |
| Vector | AAVrh8-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAV2/8CMVeGFP | CMV-eGFP | University of Iowa Viral Vector Core |
Show Experiments (4)
|
| Vector | AAV9-Ai9-sgRNA1 + sgRNA2 | AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAV9-Ai9-sgRNA2-CB-SaCas9 | AAV serotype 9 delivering gRNA 2 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAVcc47-Ai9-sgRNA1-CB-SaCas9 | AAVcc47 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAVcc47-SaCas9/guide DMD | All-in-one vector casette (CMV-saCas9-U6-gRNA [human/rhesus DMD intron]) | Asokan/Gersbach Labs | |
| Vector | AAVcc81-GFP | AAV2/9 self complementary vector with capsid variant cc81 expressing GFP driven by CBh promoter | Asokan Lab | |
| Vector | AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-LoxP2 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA | Deverman Lab | |
| Vector | AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R1 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA | Deverman Lab | |
| Vector | AAV-CMV-SaCas9-U6-modified scaffold-Sa-L2 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence | Deverman Lab | |
| Vector | AAV-CMV-SaCas9-U6-modified scaffold-Sa-R1 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA with modified scaffold sequence | Deverman Lab | |
| Vector | AAV-Pcsk9 | |||
| Vector | AAV3b-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAV9-Ai9-sgRNA1-CB-SaCas9 | AAV serotype 9 delivering sgRNA 1 + CB SaCas9 targeting the Ai9 locus | Asokan Lab | |
| Vector | AAV9-SaCas9/guide DMD | All-in-one vector casette (CMV-saCas9-U6-gRNA [human/rhesus DMD intron]) | Asokan/Gersbach Labs | |
| Vector | AAVcc47-CMV-SaCas9 | AAVcc47 delivering CMV driven SaCas9 | Asokan Lab | |
| Vector | AAVcc47-Cre | AAV2/5 expressing Cre recombinase | Asokan Lab | |
| Vector | AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-R2 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA | Deverman Lab | |
| Vector | AAV2/9CMVeGFP | CMV-eGFP | University of Iowa Viral Vector Core |
Show Experiments (4)
|
| Vector | AAVcc47_pTR_self comp 2xU6-Ai9 guides | AAVcc47 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene | Asokan Lab | |
| Vector | AAV2/2CMVeGFP | CMV-eGFP | University of Iowa Viral Vector Core |
Show Experiments (5)
|
| Vector | AAVcc47-SaCas9-Ai9 | AAV2/9 expressing SaCas9 and single sgRNA under U6 promoter | Asokan Lab | |
| Vector | AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L3 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA | Deverman Lab | |
| Vector | AAV7-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Vector | AAV9_pTR_self comp 2xU6-Ai9 guides | AAV serotype 9 delivering u6 promoter driving sgRNA 1 + sgRNA2 (self complementray vector) targeting Ai9 transgene | Asokan Lab | |
| Vector | AAV-CMV-SaCas9-U6-gRNA-LoxP-Sa-L2 | AAV shuttle vector with CMV promoter driven SaCas9 and U6 promoter driven gRNA | Deverman Lab | |
| Vector | AAVrh10-ZsGreen-Cre | AAV backbone with a bi-directional promoter driving zsGreen and Cre | Guangping Gao Lab |
Show Experiments (1) |
| Guide | DMD low gRNA-2 | One of two low-off target gRNAs delivred by dual gRNA AAV vector AAV-gRNA | VectorBuilder | |
| Genome Editor | SaCas9 (AAV-SaCas9) | SaCas9 delivered by AAV-SaCas9 vector | VectorBuilder | |
| Genome Editor | Cre recombinase | Cre recombinase delivered by AAV (see vector details) |
Show Experiments (4)
|
|
| Protocol | Deverman_AAV Production and Administration Protocol | Published procedures for AAV production, delivery, and tissue imaging. Challis et al. Systemic AAV vectors for widespread and targeted gene delivery in rodents. Nat Protoc. 2019 Feb;14(2):379-414. doi: 10.1038/s41596-018-0097-3. | ||
| Vector | BI28:AAV-GFAP-SaCas9-WPRE3-pA | Novel engineered AAV BI28 variant expressing S. aureus Cas9 driven by the glial fibrillary acidic protein (GFAP) promoter | Deverman Lab | |
| Protocol | Deverman_Comprehensive Methods | Procedure for plasmid cloning, editing evaluation in fibroblast, AAV production and administration, tissue processing and IHC. | ||
| Model System | CD4/CD8 Human Primary T cell | CD4/CD8 Human Primary T cell | Key Biologicals |
Show Experiments (1) |
| Protocol | Tsai_T Cell Transfection Protocol | Procedure for T cell transfection. |
Show Experiments (1) |
|
| Experiment | A novel human T cell platform to define biological adverse effects of genome editing | 110 guide RNAs and SpCas9 were transfected into human T-cells. Indel rates were measured by targeted amplicon deep sequencing. | ||
| Delivery System | P3 Nucleofection Kit | Nuceleofection kit to be used with Lonza's nucleofection system. | Lonza #V4SP-3096 |
Show Experiments (1) |
| Vector | BI28:AAV-GFAP-NLS-GFP-WPRE-synpA-L1-R2 | Novel engineered AAV BI28 variant expressing NLS-GFP driven by the glial fibrillary acidic protein (GFAP) promoter and dual sgRNAs with modified scaffolds | Deverman Lab | |
| Genome Editor | SpCas9 | HA-SV40NLS-SpCas9-SV40NLS | Vector Encoded | |
| Model System | Ai9 mouse | Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. | The Jackson Laboratory |
Show Experiments (11)
|
| Experiment | Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. | 3e11 vg/mouse of AAV-BI28:GFAP-SaCas9-WPRE-pA and 3e11 vg/mouse of AAV-BI28:GFAP-NLS-GFP-U6-L1-U6-R2 were codelivered intravenously to adult male and female Ai9 mice. Editing was assessed in brain sections 4 weeks later. | ||
| Publication | CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity. | Current methods can illuminate the genome-wide activity of CRISPR-Cas9 nucleases, but are not easily scalable to the throughput needed to fully understand the principles that govern Cas9 specificity. Here we describe 'circularization for high-throughput analysis of nuclease genome-wide effects by sequencing' (CHANGE-seq), a scalable, automatable tagmentation-based method for measuring the genome-wide activity of Cas9 in vitro. We applied CHANGE-seq to 110 single guide RNA targets across 13 therapeutically relevant loci in human primary T cells and identified 201,934 off-target sites, enabling the training of a machine learning model to predict off-target activity. Comparing matched genome-wide off-target, chromatin modification and accessibility, and transcriptional data, we found that cellular off-target activity was two to four times more likely to occur near active promoters, enhancers and transcribed regions. Finally, CHANGE-seq analysis of six targets across eight individual genomes revealed that human single-nucleotide variation had significant effects on activity at ~15.2% of off-target sites analyzed. CHANGE-seq is a simplified, sensitive and scalable approach to understanding the specificity of genome editors. | ||
| Experiment | Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intramuscular administration to rhesus macaques | Phase II, AAV9 (n=4) and AAVcc47 (n=4) were administered via intramuscular injection in rhesus macaques and organs were harvested 4 weeks post injection. | ||
| Experiment | Evaluation of DNA damage, cellular toxicity and inflammatory markers following saCas9 and gRNAs delivery by AAV2 in kidney organoids. | AAV2 that carries saCas9 and AAV2 carrying two gRNAs against DMD gene and mCherry were used in kidney organoids to assess toxicity compared to AAV2-GFP or mock transduced kidney organoids. | ||
| Genome Editor | SaCas9 | Asokan lab | ||
| Guide | JCR183 | guide targeting an intronic seqeunce within the Rhesus and human DMD gene | AAV encoded (see vector details) | |
| Antibody | RRID:AB_298118 | Rat anti-e-cadherin monoclonal antibody |
Show Experiments (1) |
|
| Antibody | RRID:AB_307284 | Mouse anti-CD31 monoclonal antibody |
Show Experiments (1) |
|
| Antibody | RRID:AB_2336558 | Lotus tetragonolobus lectin (LTL) | ||
| Antibody | RRID:AB_2116561 | Goat anti-KIM1/HAVCR | ||
| Vector | demo VV02-Cre | DEMO viral vector for demo purpose | Virus Company X | |
| Model System | Human kidney organoid (ESC-derived) | Kidney organoid derived from human female H9 embryonic stem cells | Morizane lab | |
| Guide | DMD low gRNA-1 | One of two low-off target gRNAs delivred by dual gRNA AAV vector pAAV[2gRNA]-mCherry-U6>{SagRNA#1*}:{SagRNA#2} | VectorBuilder |
Show Experiments (1) |
| Antibody | RRID:AB_777165 | Rabbit anti-PDGFRb monoclonal antibody |
Show Experiments (1) |
|
| Antibody | RRID:AB_2118010 | Rabbit anti-Phospho-Histone H2A.X (Ser139) | ||
| Vector | demo VV03-Cre | DEMO viral vector for demo purpose | Virus Company X | |
| Model System | Human kidney organoid (stem cell-derived) | Kidney organoid derived from human female H9 ES or BJFF iPS cells | Morizane lab |
Show Experiments (4)
|
| Antibody | RRID:AB_354920 | Goat anti-podocalyxin polyclonal antibody | ||
| Antibody | mouse anti-saCas9 monoclonal antibody |
Show Experiments (1) |
||
| Experiment | Biomarker assays to evaluate toxicity and inflammation induced by AAVs in ES cell derived kidney organoids. | Human kidney organoids generated from human ES are used to evaluate toxicity and inflammation induced by AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 . MCP-1 and KIM-1 levels were measured using Luminex (Bioplex 200). | ||
| Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) | A dual vector strategy was employed: one delivering a single guide RNA and CB driven SaCas9, and another delivering the second guide RNA and CB driven SaCas9. This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 2e12vg was injected into each mouse (1e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) | A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=3) and AAVcc47 (n=3) by intravenous injection in Ai9 mice. A total dose of 3e12vg was injected into each mouse (1.5e12vg each vector mixed 1:1) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Model System | kidney organoid | kidney organoid derived from human iPS cells | Coriell Institute for Medical Research |
Show Experiments (1) |
| Experiment | Cre Recombinase dose escalation study in Ai9 mice | A single stranded cmv cre cassette was packaged into AAV9 or AAVcc47 and injected intravenously in Ai9 mice. We injected n=3 at three different doses (1e10, 1e11, 1e12 vg) and harvested organs 4 weeks post injection. Fluorescence intensity in liver, heart, and skeletal muscle was quantified with tiff based images in Image J and neuronal transduction from each vector was quantified at the 1e12vg dose by counting the number of tdTomato+ neurons and number of NeuN+ cells from multiple sections and images. | ||
| Model System | Human kidney organoid (iPSC-derived) | Kidney organoid derived from human male BJFF iPS cells | Morizane lab | |
| Antibody | RRID:AB_2336558 | Lotus tetragonolobus lectin (LTL) |
Show Experiments (4) |
|
| Antibody | RRID:AB_2750570 | Mouse anti-meis1/2/3 | ||
| Antibody | RRID:AB_307284 | Mouse anti-CD31 antibody | ||
| Experiment | Delivery of saCas9 and gRNAs to nephron epithelia by AAV2 in kidney organoids. | An AAV2 viral vector carrying SaCas9 and AAV2 vector expressing mCherry and carrying two gRNAs against the DMD gene were used in human kidney organoids to assess transgene delivery to nephron epithelia. Organoids were treated with both AAVs at MOI 10^5 for one week. Delivery of Cas9 and gRNA vectors to nephron cell types were evaluted by immunohistochemistry. Note: additional data not shown demonstrated mCherry and SaCas9 were not detectable in non-transduced cells. | ||
| Vector | demo VV04-Cre | DEMO viral vector for demo purpose | Virus Company X | |
| Vector | demo VV05-Cre | DEMO viral vector for demo purpose | Virus Company X | |
| Antibody | RRID:AB_300798 | Chicken anti-GFP polyclonal antibody | ||
| Antibody | RRID:AB_2722769 | Chicken anti-mCherry antibody |
Show Experiments (1) |
|
| Antibody | mouse anti-saCas9 monoclonal antibody |
Show Experiments (1) |
||
| Experiment | Large animal testing of AAV9 vs AAVcc47 (Asokan lab's novel capsid) via intravenous administration to rhesus macaques | Phase I, AAV9 (n=4) and AAVcc47 (n=4) were administered via intravenous injection in rhesus macaques and organs were harvested 4 weeks post injection. | ||
| Experiment | Biomarker assays to evaluate toxicity induced by AAVs in iPS cell derived kidney organoids. | Human kidney organoids generated from human iPS cells are used to evaluate toxicity induced by AAV2, AAV8, and AAV9 that express eGFP under CMV promoter. Organoids are exposed to AAVs at MOI 10^5 . KIM-1 levels were measured using Luminex (Bioplex 200). | ||
| Vector | demo VV01-Cre | DEMO viral vector for demo purpose | Virus Company X | |
| Genome Editor | Alt-R™ S.p. HiFi Cas9 Nuclease V3 | Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol. Has improved specificity based on reduced off-target effects. | Integrated DNA Technologies (IDT) |
Show Experiments (1) |
| Delivery System | CRISPRMAX | Thermo Fisher |
Show Experiments (1) |
|
| Genome Editor | SaCas9 | Leong Lab |
Show Experiments (1) |
|
| Guide | Sa_Ai9_L | This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) |
Show Experiments (1) |
|
| Antibody | RRID:AB_10563941 | Polyclonal rabbit anti-RFP antibody |
Show Experiments (1) |
|
| Guide | Sa_Ai9_R | This gRNA targets the Ai9 and related transgenes, has modified scaffold (Tabebordbar Science 2016) |
Show Experiments (1) |
|
| Publication | Focused ultrasound-mediated brain genome editing. | Gene editing in the brain has been challenging because of the restricted transport imposed by the blood-brain barrier (BBB). Current approaches mainly rely on local injection to bypass the BBB. However, such administration is highly invasive and not amenable to treating certain delicate regions of the brain. We demonstrate a safe and effective gene editing technique by using focused ultrasound (FUS) to transiently open the BBB for the transport of intravenously delivered CRISPR/Cas9 machinery to the brain. | ||
| Experiment | FUS (focused ultrasound) array validation in Ai9 mice | 9.3 week-old Ai9 mice (4 male and 4 female) were administered Ai9-targeting SaCas9 AAV9 vector through intravenous adminsitration (2E12 vg/mouse) and left hemisphere was targeted by FUS (focused ultrasound) array for BBB (blood brain barrier) opening | ||
| Vector | Ai9LR21-SaCas9 | AAV9 encoding S. aureus Cas9 and two guide RNAs with modified scaffolds | Leong Lab |
Show Experiments (1) |
| Guide | GFP-cRNA | IDT |
Show Experiments (1) |
|
| Experiment | Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) | A dual vector strategy was employed: one delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (both single stranded AAV cassettes). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=5) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:4 ratio of cas9 to guide RNA (1e12vg of CMV Sacas9 vector and 3e12vg of the sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Model System | TLR-2 mouse | R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways. | The Jackson Laboratory |
Show Experiments (1) |
| Experiment | Testing AAV5 for activation of tdTomato in mouse airway | AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Viral delivery was detected by GFP expression and gene editing quantified by tdTomato activation | ||
| Experiment | Analysis of editing outcomes and adverse events in human kidney organoids | Kidney organoids were derived from a human iPS cell line expressing GFP from the safe harbor locus. These were transfected with a commercially available CRISPR ribonucleoprotein complex with guide RNA targeting GFP or a scrambled sequence (control). Editing events were assessed by next generation sequencing of the GFP locus. | ||
| Experiment | Testing AAV5 for activation of tdTomato in HEK293T cells | AAV shuttle plasmids expressing SpCas9 and guide RNAs targeting the Ai9 transgene were tested in HEK293T cells by transient transfection. Both delivery and gene editing were detected by fluorescence. | ||
| Experiment | Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells | AAV2/5 mediated gene editing in the mouse airway was tested by deliverying SpCas9 and guide RNAs targeting the Ai9 transgene in Ai9 transgenic mice. Gene editing quantified by tdTomato activation and cell specific markers for club and ciliated cell types. | ||
| Experiment | [Validation] Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain | Validation of delivery of AAV custom designed to cross the blood-brain barrier for CRISPR/Cas9 editing. Editing detected and quantified in brain by generation of tdTomato fluorescent protein signal from Ai9 reporter mice | ||
| Experiment | Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. | A dual vector strategy was employed: one self complementary vector delivering two single guide RNAs targeting the Rosa26 locus and one delivering CMV driven SaCas9 (single stranded vector). This strategy was evaluted with both AAV9 (n=4) and AAVcc47 (n=4) by intravenous injection in Ai9 mice. A total dose of 4e12vg was injected into each mouse and vectors mixed in a 1:1 ratio of cas9 to guide RNA (2e12vg of CMV Sacas9 vector and 2e12vg of the self complementary sgRNA vector) and organs were harvested 4 weeks post injection. Editing efficency was determined by calculating percent TdTomato+ cells normalized to Dapi+ cells in liver and heart. | ||
| Model System | C57BL/6 mouse (Asokan study) | Unspecified | ||
| Experiment | Testing virus region 8 (VR8) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. | C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding a GFP reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification. | ||
| Experiment | Testing virus region 4 (VR4) mutant cross-species compatible Adeno Associated Viruses (ccAAVs) in mice. | C57BL/6 mice (N=3) were injected intravenously at a dose of 5e13 vg/kg per mouse with a self-complementary AAV9 or ccAAV vector encoding an mCherry reporter. The biodistribution of of virus transduction was chacterized in various tissues and cell types by fluorescence imaging quantification. | ||
| Genome Editor | SaCas9-Lagor | William Lagor, Baylor College Of Medicine |
Show Experiments (4)
|
|
| Project | Novel AAVs Engineered for Efficient and Noninvasive Cross-Species Gene Editing Throughout the Central Nervous System | This project aims to advance the NIH Somatic Cell Genome Editing Program’s objective to identify novel delivery technologies that enable genome editing in therapeutically relevant somatic cell populations. We will use proven virus engineering methods to develop new vehicles that can deliver genome editing machinery throughout the adult mammalian central nervous system. Accomplishing this objective would pave the road for applying gene editing, and gene therapy more broadly, to the study and treatment of neurological and psychiatric disorders. | ||
| Project | Vascularized kidney organoids on chip for efficacy and toxicity testing of somatic genome editing | The proposed work will take advantage of the state-of-the-art technology of kidney organoids that we recently generated from human pluripotent stem cells (hPSCs) and further advance this technology toward the goal of establishing kidney tissue platforms for assessment of somatic genome editing. We will optimize kidney organoid generation and AAV transduction for assessment of adverse effects of CRISR genome editing. Further, we will incorporate the 3D-printed vascular system into kidney organoids to simulate in vivo pharmacokinetics and pharmacodynamics on chips. |
Show Experiments (7)
|
|
| Guide | L3-modifed | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | R2-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | L2-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Genome Editor | SaCas9 |
Show Experiments (3) |
||
| Guide | R1-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | SaLoxP1-modified | This gRNA targets the mTmG, Ai9 and related transgenes at two sites | Vector encoded | |
| Guide | SaLoxP2-unmodified | This gRNA targets the mTmG, Ai9 and related transgenes at two sites | Vector encoded | |
| Guide | L1-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded |
Show Experiments (3) |
| Guide | sgAi9L | This sgRNA targets the Ai9 and related transgenes | IDT | |
| Guide | Ai9 SaCas9 Guide B | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Genome Editor | SauCas9 | |||
| Model System | Ai9 mouse immortalized fibroblasts | Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice | ||
| Experiment | Selection of gRNA sequences and gRNA scaffold modification lead to improved editing of the Ai9 locus in vitro | Reporter transgene activation by SaCas9 gRNA target and modified scaffold sequences by transient transfection in immortalized Ai9 mouse fibroblasts | ||
| Guide | L1-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | L3-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | R1-unmodified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | SaLoxP1-unmodified | This gRNA targets the mTmG, Ai9 and related transgenes at two sites | Vector encoded | |
| Guide | L2-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Guide | SaLoxP2-modified | This gRNA targets the mTmG, Ai9 and related transgenes at two sites | Vector encoded | |
| Protocol | Deverman_Area Based Quantification of Editing Efficiency Protocol | Procedure for non-IHC based image quantification of editing. | ||
| Guide | R2-modified | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Model System | Ai9 mouse (BCM) | Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. | Baylor College of Medicine | |
| Guide | Ai9 SaCas9 Guide A | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Protocol | Heaney_SATC Tissue Processing, Imaging and Analysis | Procedure for tissue preparation, imaging and analysis. |
Show Experiments (4)
|
|
| Antibody | Anti-RFP (Mouse) Monoclonal Antibody, dilution used 1:300 |
Show Experiments (1) |
||
| Protocol | Chaikof-Associated Protocol 2_Off-target editing AND Primers for sequencing analysis | This protocol describes in vivo adminstration and subsequent analysis of off-target editing in the liver. | ||
| Guide | sgAi9R | This sgRNA targets the Ai9 and related transgenes | IDT | |
| Model System | C57BL/6J mouse | C57BL/6J WT mouse | The Jackson Laboratory |
Show Experiments (3) |
| Vector | H509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) | AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP | Gao Lab | |
| Antibody | GFP (D5.1) XP Rabbit mAb antibody |
Show Experiments (1) |
||
| Antibody | Anti-RFP (RABBIT) Antibody |
Show Experiments (1) |
||
| Antibody | Anti-alpha Tubulin (Mouse) Monoclonal Antibody, dilution used 1:200 |
Show Experiments (1) |
||
| Model System | HEK-293T with Ai9 transient reporter assay | HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. |
Show Experiments (1) |
|
| Antibody | Anti-CC10 (Rabbit) Polyclonal Antibody, dilution used 1:2,000 |
Show Experiments (1) |
||
| Antibody | Anti-RFP (Rabbit) Polyclonal Antibody |
Show Experiments (1) |
||
| Genome Editor | TadA-8e V106W | Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W) | Chaikof Lab | |
| Delivery System | Lipofectamine 3000 | Lipid nanoparticle | Thermo Fisher Scientific | |
| Delivery System | eVLP | engineered virus like particles | Liu Lab |
Show Experiments (3)
|
| Vector | pH509 AAVsc-u6-sgAI9L-U6-AI9R-U1A-EGFP (1) | AAV2/5 expressing SpyCas9. AAV2/5 expressing two sgRNAs under U6 promoter and eGFP | Gao Lab |
Show Experiments (1) |
| Genome Editor | Cre recombinase | Cre recombinase delivered by plasmid (see vector details) |
Show Experiments (1) |
|
| Publication | Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. | Methods to deliver gene editing agents in vivo as ribonucleoproteins could offer safety advantages over nucleic acid delivery approaches. We report the development and application of engineered DNA-free virus-like particles (eVLPs) that efficiently package and deliver base editor or Cas9 ribonucleoproteins. By engineering VLPs to overcome cargo packaging, release, and localization bottlenecks, we developed fourth-generation eVLPs that mediate efficient base editing in several primary mouse and human cell types. Using different glycoproteins in eVLPs alters their cellular tropism. Single injections of eVLPs into mice support therapeutic levels of base editing in multiple tissues, reducing serum Pcsk9 levels 78% following 63% liver editing, and partially restoring visual function in a mouse model of genetic blindness. In vitro and in vivo off-target editing from eVLPs was virtually undetected, an improvement over AAV or plasmid delivery. These results establish eVLPs as promising vehicles for therapeutic macromolecule delivery that combine key advantages of both viral and nonviral delivery. | ||
| Guide | BCM_ssAAV5-Sp_sgB | This sgRNA targets the Ai9 and related transgenes | Vector encoded | |
| Vector | scAAV5-Cre-GFP | Gao Lab | ||
| Experiment | [Validation] Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice | AAV5 encoding CRISPR/Cas editing machinery were delivered to the lungs of reporter mice by intratracheal instillation. After 4 weeks incubation, the mice were dissected and the lungs imaged for the presence of tdTomato fluorescence, indicating successful editing. Editing calculated by dividing the number of tdTomato+ red cells by the number of nuclei in each airway | ||
| Guide | BCM_ssAAV5-Sa_sgB | This gRNA targets the Ai9 and related transgenes | Vector encoded | |
| Vector | ssAAV5-sgA+sgB-U1A.GFP | Gao Lab | ||
| Vector | ssAAV5-sgB.saCas9 | Gao Lab | ||
| Guide | BCM_ssAAV5-Sp_sgA | This sgRNA targets the Ai9 and related transgenes | Vector encoded | |
| Genome Editor | SaCas9 | Vector Encoded (ssaav5-sga+sgb-u1a.gfp) | ||
| Vector | ssAAV5-spCas9 | Gao Lab | ||
| Model System | Ai9-SauSpyCas9 mouse | Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. | Baylor College of Medicine | |
| Genome Editor | SpCas9 | IDT |