Development System
g-38330_C12a | SCGE Toolkit
gRNA targeting HPRT locus
| 10000000201 |
| g-38330_C12a |
| IDT |
| HPRT |
| human |
| gRNA targeting HPRT locus |
| AsCas12a |
|
| GGTTAAAGATGGTTAAATGAT |
| TTTAGGTTAAAGATGGTTAAATGAT |
| hg38/chrX:134498461-134498481 |
|
| GGUUAAAGAUGGUUAAAUGAU |
| 21 |
| none |
| Publication Title |
|
Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia. NCBI |
This Guide: g-38330_C12a is being used ...
| Project |
Initiative |
Contact PI |
|
|
|
Delivery Systems |
Paul B McCray, Jr, MD
(University of Iowa) |
|