Development System
g-11_C9 | SCGE Toolkit
sgRNA targeting CFTR exon 11
| 10000000202 |
| g-11_C9 |
| IDT |
| CFTR |
| human |
| sgRNA targeting CFTR exon 11 |
| SpyCas9 |
|
| TCTGTATCTATATTCATCAT |
| TCTGTATCTATATTCATCATAGG |
| hg38/chr7:117559606-117559625 |
|
| UCUGUAUCUAUAUUCAUCAU |
| 20 |
| none |
| Publication Title |
|
Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia. NCBI |
This Guide: g-11_C9 is being used ...
| Project |
Initiative |
Contact PI |
|
|
|
Delivery Systems |
Paul B McCray, Jr, MD
(University of Iowa) |
|