Development System
CCR5_site_09 | SCGE Toolkit
Targets endogenous human locus
    
    
    
    
    
        
        
        
        
            
                
                    
                        
                        
                        
                        
                        
                        
                            
                        
                    
                        
                        
                            
                            
                            
                        
 
    
    
        
            
                
                
                    
                        
                            
                        
                        
                    
                    
                        | 10000000120 | 
                    
                        | CCR5_site_09 | 
                    
                        | lab IVT | 
                    
                        | CCR5 | 
                    
                        | human | 
                    
                        | Targets endogenous human locus | 
                    
                        | SpyCas9 | 
                    
                
                    
                        
                        
                            | 
 | 
                        
                    
                    
                        | GGTACCTATCGATTGTCAGG | 
                    
                        | GGTACCTATCGATTGTCAGGNGG | 
                    
                        | hg38/chr3:46373261-46373284 | 
                    
                
                    
                        
                        
                            | 
 | 
                        
                    
                    
                        | GGUACCUAUCGAUUGUCAGG | 
                    
                        | 20 | 
                    
                        | none | 
                    
                
                    
                        
                        
                            | 
 | 
                        
                    
                    
                        | CCTGCTCAACCTGGCCATCTCTGA | 
                    
                        | ACGCAAACACAGCCACCACCCAA | 
                    
                
            
         
     
 
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
    
        
        
            
                | 
                        | Ivt Construct Source | Addgene |  | Vector Id | 153997 |  | Vector Name | pCRL01 |  | Vector Description | Plasmid for single guide RNA IVT |  | Vector Type | plasmid |  | Annotated Map | addgene-plasmid-153997-sequence-304516 |  |  | 
        
     
    
    
    
    
        
        
            
                | 
                        | Detection Method | No. of sites detected | 
|---|
 
                            | Change-seq | 46 
 |  
                            | Guide-seq | 6 
 |  |  | 
        
        
        
        
     
    
    
        
        
    
    
    
    
    
        
    
    
        
            
            
                
                | Publication Title | 
            
            
            
                
                    
                    | CHANGE-seq reveals genetic and epigenetic effects on CRISPR-Cas9 genome-wide activity. NCBI | 
            
            
        
    
     
    
        
 This Guide: CCR5_site_09 is being used ...
    
    
        
        | Project | Initiative | Contact PI |  | 
    
    
    
    
        
            |  | Biological Effects | Shengdar Q Tsai, PhD (St. Jude Children's Research Hospital)
 |   |