Model System: Ai9-SauSpyCas9 mouse
Summary
| SCGE ID | 13000000042 |
| Name | Ai9-SauSpyCas9 mouse |
| Official Name | B6.Cg-Gt(ROSA)26Sorem1(CAG-tdTomato)JaHe |
| Alias | SaSp Ai9, SaSp single-guide Ai9 |
| Species | Mouse |
| Type | Animal |
| Description | Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. |
| Source | Baylor College of Medicine |
| RRID | RRID:MMRRC_068227-JAX |
| Transgene | CAG-lox-stop-lox-tdTomato |
| Transgene Description | modified Ai9 allele for single target site flanking 3xStop cassette |
| Reporter | tdTomato |
Projects & Experiments
This Model System: Ai9-SauSpyCas9 mouse is being used ...| Project | Initiative | Contact PI | |
|---|---|---|---|
| Animal Reporter and Testing Center |
Jason D Heaney, PhD
(Baylor College of Medicine) |
|