Alt-R® S.p. Cas9 Nuclease V3 | SCGE Toolkit>

SCGE Consortium Home | About SCGE | Contact Us | Citing the Toolkit | License

Genome Editor: Alt-R® S.p. Cas9 Nuclease V3

Summary Related Guides Projects & Experiments

SCGE ID	11000000118
Symbol	Alt-R® S.p. Cas9 Nuclease V3
Species	Streptococcus pyogenes
Type	Cas Nuclease
Subtype	Cas9

Activity	Double strand cleavage
Substrate	double stranded DNA
DSB Cleavage Type	Blunt
PAM	3' NGG
Fusion	NLS

Source	Integrated DNA Technologies

CATTATACGAAGTTATATTA

This Genome Editor: Alt-R® S.p. Cas9 Nuclease V3 is being used

Project	Initiative	Contact PI
Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Experiments Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia	Delivery Systems Initiative	Paul B McCray, Jr, MD (University of Iowa)