Alt-R® S.p. Cas9 Nuclease V3 | SCGE Toolkit

SCGE Consortium Home | About SCGE Toolkit | Contact Us | Citing the Toolkit | License

Summary Related Guides Projects & Experiments

SCGE ID	11000000118
Symbol	Alt-R® S.p. Cas9 Nuclease V3
Description	Recombinant S. pyogenes Cas9 nuclease, purified from an E. coli strain expressing the nuclease. Contains nuclear localization sequence (NLS) and C-terminal 6-His tag. Provided in solution at 10 µg/µL. 100 µg of Cas9 nuclease = 610 pmol.
Species	Streptococcus pyogenes
Type	Cas Nuclease
Subtype	Cas9

Activity	Double strand cleavage
Substrate	double stranded DNA
DSB Cleavage Type	Blunt
PAM	3' NGG
Fusion	NLS

Source	Integrated DNA Technologies

CATTATACGAAGTTATATTA

Publication Title
Engineered amphiphilic peptides enable delivery of proteins and CRISPR-associated nucleases to airway epithelia. NCBI

This Genome Editor: Alt-R® S.p. Cas9 Nuclease V3 is being used ...

Project	Initiative	Contact PI
The Jackson Laboratory Gene Editing Testing Center (JAX-GETC) Experiments Validating Traffic Light Reporter 7 (TLR7) Mouse Model for NHEJ in Heterozygous Blastocysts Validating Traffic Light Reporter 7 (TLR7) Mouse Model for HDR in Heterozygous Blastocysts Validating Gene Editing Reporter 12 (GER12) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 14 (GER14) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 18 (GER18) Mouse Model in Heterozygous Blastocysts Validating Gene Editing Reporter 19 (GER19) Mouse Model in Heterozygous Blastocysts	Animal Reporter and Testing Center	Stephen A Murray, PhD (Jackson Laboratory)
Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Experiments Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia	Delivery Systems	Paul B McCray, Jr, MD (University of Iowa)