AsCas12a (IDT and Feldan Therapeutics) | SCGE Toolkit>

SCGE Consortium Home | About SCGE | Contact Us | Citing the Toolkit | License

Genome Editor: AsCas12a (IDT and Feldan Therapeutics)

Summary Related Guides Projects & Experiments

SCGE ID	11000000119
Symbol	AsCas12a (IDT and Feldan Therapeutics)
Species	Acidaminococcus
Type	Cas Nuclease
Subtype	Cas12a (Cpf1)
Alias	AsCpf1

Activity	Double strand cleavage
Substrate	double stranded DNA
DSB Cleavage Type	5-bp Staggered DNA Double-strand Break Ends
PAM	3' TTTV
Fusion	NLS

Source	IDT and Feldan Therapeutics

GTATAATGTATGCTATACGAA

This Genome Editor: AsCas12a (IDT and Feldan Therapeutics) is being used

Project	Initiative	Contact PI
Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Experiments Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia	Delivery Systems Initiative	Paul B McCray, Jr, MD (University of Iowa)