Development System
Ai9 SaCas9 Guide B | SCGE Toolkit
This gRNA targets the Ai9 and related transgenes
Guide: Ai9 SaCas9 Guide B
10000000243 |
Ai9 SaCas9 Guide B |
Vector encoded |
Ai9/Ai14 reporter transgene |
Transgene |
This gRNA targets the Ai9 and related transgenes |
SauCas9 |
|
CTCTAGAGTCGCAGATCCTC |
CTCTAGAGTCGCAGATCCTCTAGAGT |
|
CUCUAGAGUCGCAGAUCCUC |
20 |
none |
This Guide: Ai9 SaCas9 Guide B is being used
Project |
Initiative |
Contact PI |
|
|
Animal Reporter and Testing Center Initiative |
Jason D Heaney, PhD
(Duke University) |
|