Development System
Cas12j-GFP10 (CasΦ-3) | SCGE Toolkit
Guide targeting eGFP compatible with CasΦ-3
| 10000000280 |
| Cas12j-GFP10 (CasΦ-3) |
| eGFP |
| transgene |
| Guide targeting eGFP compatible with CasΦ-3 |
| CasΦ-3 |
|
| ACCAGGGTGTCGCCCTCGAA |
| GTTCACCAGGGTGTCGCCCTCGAA |
|
| UGCCCAGUACGCUGGGACACCAGGGUGUCGCCCUCGAA |
| ACCAGGGUGUCGCCCUCGAA |
| 20 |
| none |
| Publication Title |
|
CRISPR-CasΦ from huge phages is a hypercompact genome editor. NCBI |
This Guide: Cas12j-GFP10 (CasΦ-3) is being used ...
| Project |
Initiative |
Contact PI |
|
|
|
Genome Editors |
Jennifer A Doudna, PhD
Jillian Banfield, PhD
(University of California, Berkeley) |
|