TadA-8e V106W | SCGE Toolkit

SCGE Consortium Home | About SCGE Toolkit | Contact Us | Citing the Toolkit | License

Summary Related Guides Projects & Experiments

SCGE ID	11000000151
Symbol	TadA-8e V106W
Description	Catalytically impaired Cas fused to evolved TadA deaminase (TadA-8e V106W)
Species	S. pyogenes (Cas); E. coli (TadA)
Type	Base Editor (SpCas9)
Subtype	Adenine base editor

Activity	A-to-G base edit
Substrate	double stranded DNA
PAM	NGG
Variant	TadA-8e V106W

Source	Chaikof Lab

CCCATACCTTGGAGCAACGG

Publication Title
Engineered virus-like particles for efficient in vivo delivery of therapeutic proteins. NCBI

This Genome Editor: TadA-8e V106W is being used ...

Project	Initiative	Contact PI
Delivery Technologies for In Vivo Genome Editing Experiments Pcsk9 adenine base editor efficiency in liver and nonliver tissue On-target editing compared to 14 circle-seq nominated off-target sites of adenine base editor delivered by BE-eVLP vs AAV in the C57BL/6 liver	Delivery Systems	Elliot L. Chaikof, MD, PhD (Beth Israel Deaconess Medical Center)