SCGE ID10000000246
Lab IDsg298
SourceSynthego
Target LocusAi9/Ai14 reporter transgene
Speciestransgene
DescriptionThis sgRNA targets the Ai9 and related transgenes at multiple sites. 2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases
Guide CompatibilitySpyCas9

Target SequenceAAGTAAAACCTCTACAAATG
Target Sequence + PAMAAGTAAAACCTCTACAAATGTGG

Spacer SequenceAAGUAAAACCUCUACAAAUG
Spacer Length20
Modifications2'-O-Methyl at 3 first and last bases, 3' phosphorothioate bonds between first 3 and last 2 bases

  • Ai14 gRNA
  • sg298

  • CleanCap® Cas9 mRNA (5moU)



  • This Guide: sg298 is being used ...
    Project Initiative Contact PI
    Animal Reporter and Testing Center Initiative Stephen A Murray, PhD
    (Jackson Laboratory)
    NIH Report