sNLS-SpCas9-sNLS | SCGE Toolkit

SCGE Consortium Home | About SCGE Toolkit | Contact Us | Citing the Toolkit | License

Summary Related Guides Projects & Experiments

SCGE ID	11000000133
Symbol	sNLS-SpCas9-sNLS
Description	SpCas9 with N- and C-terminal SV40 NLS
Species	Streptococcus pyogenes
Type	Cas Nuclease
Subtype	Cas9

Activity	Double strand cleavage
Substrate	double stranded DNA
DSB Cleavage Type	Blunt
PAM	3' NGG
Fusion	N- and C-terminal SV40 NLS

Source	Aldevron 9212-5MG

AAGTAAAACCTCTACAAATG

This Genome Editor: sNLS-SpCas9-sNLS is being used

Project	Initiative	Contact PI
Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain Experiments Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.	Delivery Systems Initiative	Shaoqin (Sarah) Gong, PhD (University of Wisconsin-Madison)