7 results for search term 'ai9'  in category Model System

Ai9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System name : Ai9 mouse description : Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent guide : Sa_Ai9_L Sa_Ai9_R
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.
Show Experiments (11)

Ai9-SauSpyCas9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System name : Ai9-SauSpyCas9 mouse description : Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9
Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.

Ai9 mouse (BCM)

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System name : Ai9 mouse (BCM) description : Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent guide : Ai9 SaCas9 Guide A Ai9 SaCas9 Guide B
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.

Ai9 mouse immortalized fibroblasts

Model System  - [In Vitro] [Mouse]
Matched Fields: category : Model System name : Ai9 mouse immortalized fibroblasts description : Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice
Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice

HEK-293T with Ai9 transient reporter assay

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System name : HEK-293T with Ai9 transient reporter assay description : HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing
HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.

Ai14 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System guide : Ai14 gRNA
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

Ai14 mouse (congenic)

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System guide : Ai14 gRNA
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

7 results for search term 'ai9'  in category Model System

Type Organism Subtype Name Description Source View Associated...
Animal Mouse Ai9 mouse Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The Jackson Laboratory
Show Experiments (11)
Animal Mouse Ai9-SauSpyCas9 mouse Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Baylor College of Medicine
Animal Mouse Ai9 mouse (BCM) Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Baylor College of Medicine
Cell Mouse Immortalized Fibroblast (unspecified) Ai9 mouse immortalized fibroblasts Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice
Cell Human Immortalized HEK-293T with Ai9 transient reporter assay HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.
Animal Mouse Ai14 mouse Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory
Animal Mouse Ai14 mouse (congenic) Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory