Search Results | SCGE Toolkit

SCGE Consortium Home | About SCGE Toolkit | Contact Us | Citing the Toolkit | License

Table View
List View

17 results for search term 'CRISPR' in category Model System

Ai14 mouse (congenic) Model System - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System experimentName : Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Ai9 mouse Model System - [In Vivo] [Delivery Systems, AAV tropism, Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases experimentName : Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
HEK-293T-disrupted_GFP-mcherry-Puro Model System - [In Vitro] [Delivery Systems] [Human] Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors HEK293T cells with an integrated reporter for TLR1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells
HEK-293T-disrupted_GFP with MCV-mcherry-Puro Model System - [In Vitro] [Delivery Systems] [Human] Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors HEK293T cells with an integrated reporter for TLR-MCV1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells
Hepa1-6 Model System - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Stable mouse cell line of liver epithelial cells. Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells
TLR-MCV1 mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors TLR-MCV1 transgene knocked into Rosa26 locus Show Experiments (1) Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain
Ai9-SauSpyCas9 mouse Model System - [In Vivo] [Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System description : Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
mTmG mouse (congenic) Model System - [In Vivo] [Delivery Systems, Animal Reporter and Testing Center] [Mouse] Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors experimentName : Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. Show Experiments (7) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Neuro 2A Model System - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Neuro-2a cells are mouse neuroblasts with neuronal and amoeboid stem cell morphology isolated from brain tissue. Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells
BALB/c mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: category : Model System study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
Ai14 mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: category : Model System study : Enabling Nanoplatforms for Targeted In Vivo Delivery of CRISPR/Cas9 Riboncleoproteins in the Brain experimentName : Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain. Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Primary Airway Epithelia (Human) Model System - [In Vitro] [Delivery Systems, Genome Editors, Collaborative Opportunity Fund] [Human] Matched Fields: category : Model System study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Primary airway epithelia from non-CF donors Show Experiments (4) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus
mTmG mouse Model System - [In Vivo] [Delivery Systems] [Mouse] Matched Fields: category : Model System study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
HEK-293T with Ai9 transient reporter assay Model System - [In Vitro] [Delivery Systems] [Human] Matched Fields: category : Model System study : Develop Combinatorial Non-Viral and Viral CRISPR Delivery for Lung Diseases HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient. Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
NK Model System - [In Vitro] [Delivery Systems] [Human] Matched Fields: category : Model System study : Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Natural Killer cells. White blood cells; Show Experiments (1) Gene editing in vitro by various peptide variants delivering Cas12a in NK cells.
Mouse Embryonic Fibroblasts Model System - [In Vitro] [Delivery Systems] [Mouse] Matched Fields: category : Model System study : Enhancing CRISPR Gene Editing in Somatic Tissues by Chemical Modification of Guides and Donors Primary cell line Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts
HEK-293-TgEF1a-eGFP-BSD Model System - [In Vitro] [Genome Editors] [Human] Matched Fields: category : Model System study : Expanding CRISPR-Cas Editing Technology through Exploration of Novel Cas Proteins and DNA Repair Systems HEK293 cells with lentiviral insertion of EF1a promoter driving expression of eGFP and SV40 promoter driving expression of BSD. HEK293 is an epithelial-like cell that was isolated from the kidney of a patient. Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells

17 results for search term 'CRISPR' in category Model System

Type	Organism	Subtype	Name	Description	Source	View Associated...
Animal	Mouse		Ai14 mouse (congenic)	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (7) Testing new LNPs (lipid nanoparticles) for delivery of Cas9 mRNA/sgRNA in adult mouse cochlea Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain Independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Repeat experiment of independent validation of Chen delivery platform using LNPs to deliver CRISPR/Cas9 to mouse inner ear Independent validation of Gong delivery platform using RNP-loaded nanocages to deliver CRISPR/Cas9 to mouse brain
Animal	Mouse		Ai9 mouse	Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.	The Jackson Laboratory	Show Experiments (11) Testing gRNA sequence and gRNA scaffold modified in Ai9 mice. Testing AAV5 for activation of tdTomato in mouse airway Cre Recombinase dose escalation study in Ai9 mice Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CB promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficiencies between AAV9 and AAVcc47 in Ai9 mice with a 1:3 Cas9 to sgRNA ratio (CMV promoter) Comparing CRISPR/Cas9 gene editing efficencies between AAV9 and AAVcc47 in Ai9 mice with a 1:1 Cas9 to sgRNA ratio (CMV promoter) and self complementary sgRNA vector. Independent validation of Deverman delivery platform using engineered AAVs to deliver CRSIPR/Cas9 to mouse brain FUS (focused ultrasound) array validation in Ai9 mice Testing AAV5 for activation of tdTomato in mouse airway club and ciliated cells AAV Tropism project
Cell	Human	Immortalized	HEK-293T-disrupted_GFP-mcherry-Puro	HEK293T cells with an integrated reporter for TLR1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.		Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR1 reporter in human cells
Cell	Human	Immortalized	HEK-293T-disrupted_GFP with MCV-mcherry-Puro	HEK293T cells with an integrated reporter for TLR-MCV1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.		Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA to activate the TLR reporter in human cells
Cell	Mouse	Hepatoma	Hepa1-6	Stable mouse cell line of liver epithelial cells.	ATCC	Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Hepa 1-6 cells
Animal	Mouse		TLR-MCV1 mouse	TLR-MCV1 transgene knocked into Rosa26 locus		Show Experiments (1) Delivery of RNP containing chemically modified crRNA C20 with chemically modified tracrRNA T2-PS to determine the RNP distribution in TLR-MCV mouse brain
Animal	Mouse		Ai9-SauSpyCas9 mouse	Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.	Baylor College of Medicine	Show Experiments (1) Independent validation for Gao Delivery Team: Testing ssAAV5 delivered intratracheally for editing activity in lung epithelia in Ai9 mice
Animal	Mouse		mTmG mouse (congenic)	mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed.	The Jackson Laboratory	Show Experiments (7) Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA using the S10 shuttle peptide to activate the mTmG reporter in mouse brain Delivery of unmodified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Delivery of chemically modified, phosphorothioate (PS)-stabilized crRNA with chemically modified, extended PS-stabilized tracrRNA to activate the mTmG reporter in mouse brain Independent validation for McCray Delivery Team: Delivery of CRISPR Ribonucleoproteins to Airway Epithelia Using Novel Amphiphilic Peptides Testing preparation for independent validation at The Jackson Laboratory Small Animal Testing Center Independent validation of Sontheimer delivery platform using heavily modified guide RNAs complexed with Cas9 proteins to deliver CRISPR/Cas9 to mouse brain
Cell	Mouse	Neuroblastoma	Neuro 2A	Neuro-2a cells are mouse neuroblasts with neuronal and amoeboid stem cell morphology isolated from brain tissue.	ATCC	Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mouse Neuro 2A cells
Animal	Mouse		BALB/c mouse	BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO).	The Jackson Laboratory	Show Experiments (1) Testing Shuttle Peptides ability to deliver GFP-NLS to airway epithelia.
Animal	Mouse		Ai14 mouse	Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.	The Jackson Laboratory	Show Experiments (1) Enabling Nanoplatforms for Targeted in vivo Delivery of CRISPR/Cas9 Ribonucleoproteins in the Brain.
Cell	Human	Primary cells	Primary Airway Epithelia (Human)	Primary airway epithelia from non-CF donors	University of Iowa	Show Experiments (4) Peptide Shuttle optimization to deliver Cas9 RNP to human airway epithelia cells Peptide Shuttle optimization to deliver Cas12a RNP to human airway epithelia cells Gene editing in vitro by various peptide variants delivering Cas RNPs to primary Human airway epithelia cells. Delivery of Cas9 RNP using Shuttle peptide candidates to human airway epithelial cells cultured at the air liquid interface targeting CFTR locus
Animal	Mouse		mTmG mouse	ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence	The Jackson Laboratory	Show Experiments (1) Shuttle peptides enable in vivo gene editing with Cas9 and Cas12a RNP in mouse airway epithelia
Cell	Human	Immortalized	HEK-293T with Ai9 transient reporter assay	HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.		Show Experiments (1) Testing AAV5 for activation of tdTomato in HEK293T cells
Cell	Human	Primary cells	NK	Natural Killer cells. White blood cells;	GreenCross LabCell	Show Experiments (1) Gene editing in vitro by various peptide variants delivering Cas12a in NK cells.
Cell	Mouse	Primary cells	Mouse Embryonic Fibroblasts	Primary cell line	In-house: https://jacks-lab.mit.edu/protocols/making_mefs	Show Experiments (1) Testing newly chemically modified crRNA and tracrRNA in mTmG mouse embryonic fibroblasts
Cell	Human	Immortalized	HEK-293-TgEF1a-eGFP-BSD	HEK293 cells with lentiviral insertion of EF1a promoter driving expression of eGFP and SV40 promoter driving expression of BSD. HEK293 is an epithelial-like cell that was isolated from the kidney of a patient.		Show Experiments (1) Testing newly discovered Biggie Phage editors in human cells