13 results for search term 'Epithelium'  in category Model System

BALB/c mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO).

mTmG mouse (congenic)

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Ecto-epithelium Columnar epithelium Lung epithelium Epithelium
mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed.
Show Experiments (7)

Ai9 mouse (BCM)

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.

Ai9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System tissueTerm : Epithelium of main bronchus Epithelium of bronchus termSynonyms : Ecto-epithelium Ciliated epithelium Meso-epithelium Epithelium Endo-epithelium
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.
Show Experiments (11)

Macaca mulatta (Rhesus Macaque)

Model System  - [In Vivo] [Rhesus macaque]
Matched Fields: category : Model System tissueTerm : Lower respiratory tract epithelium termSynonyms : Columnar epithelium Epithelium Endo-epithelium Foregut epithelium Ciliated epithelium

mTmG mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System tissueTerm : Epithelium of bronchiole Epithelium of main bronchus termSynonyms : Lung epithelium Epithelium of mucosa Columnar epithelium Epithelium Endo-epithelium
ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence

B6

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
C57BL/6J WT mouse

C57BL/6 mouse (Asokan study)

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium

Ai9-SauSpyCas9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System tissueTerm : Epithelium of main bronchus Epithelium of bronchiole termSynonyms : Epithelium of mucosa Columnar epithelium Lung epithelium Epithelium Endo-epithelium
Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.

TLR-2 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System termSynonyms : Ecto-epithelium Columnar epithelium Epithelium Endo-epithelium Meso-epithelium
R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways.

C57BL/6J mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System termSynonyms : Columnar epithelium Epithelium Endo-epithelium Meso-epithelium Foregut epithelium
C57BL/6J WT mouse

Ai14 mouse (congenic)

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System termSynonyms : Ecto-epithelium Meso-epithelium Kidney epithelium Epithelium Endo-epithelium
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

Ai14 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System termSynonyms : Ecto-epithelium Epithelium
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

13 results for search term 'Epithelium'  in category Model System

Type Organism Subtype Name Description Source View Associated...
Animal Mouse BALB/c mouse BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). The Jackson Laboratory
Animal Mouse mTmG mouse (congenic) mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. The Jackson Laboratory
Show Experiments (7)
Animal Mouse Ai9 mouse (BCM) Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Baylor College of Medicine
Animal Mouse Ai9 mouse Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The Jackson Laboratory
Show Experiments (11)
Animal Rhesus macaque Macaca mulatta (Rhesus Macaque) Tarantal Lab
Animal Mouse mTmG mouse ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence The Jackson Laboratory
Animal Mouse B6 C57BL/6J WT mouse Baylor College of Medicine
Animal Mouse C57BL/6 mouse (Asokan study) Unspecified
Animal Mouse Ai9-SauSpyCas9 mouse Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Baylor College of Medicine
Animal Mouse TLR-2 mouse R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways. The Jackson Laboratory
Animal Mouse C57BL/6J mouse C57BL/6J WT mouse The Jackson Laboratory
Animal Mouse Ai14 mouse (congenic) Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory
Animal Mouse Ai14 mouse Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory