Search Results
13 results for search term 'Epithelium' in category Model System
BALB/c mouseModel System - [In Vivo] [Mouse]Show Experiments (1) |
mTmG mouse (congenic)Model System - [In Vivo] [Mouse]Show Experiments (7)
|
Ai9 mouse (BCM)Model System - [In Vivo] [Mouse] |
Ai9 mouseModel System - [In Vivo] [Mouse]Show Experiments (11)
|
Macaca mulatta (Rhesus Macaque)Model System - [In Vivo] [Rhesus macaque]Show Experiments (1) |
mTmG mouseModel System - [In Vivo] [Mouse] |
Ai9-SauSpyCas9 mouseModel System - [In Vivo] [Mouse] |
TLR-2 mouseModel System - [In Vivo] [Mouse]Show Experiments (1) |
Ai14 mouse (congenic)Model System - [In Vivo] [Mouse]Show Experiments (7)
|
Ai14 mouseModel System - [In Vivo] [Mouse] |
13 results for search term 'Epithelium' in category Model System
| Type | Organism | Subtype | Name | Description | Source | View Associated... |
|---|---|---|---|---|---|---|
| Animal | Mouse | BALB/c mouse | BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). | The Jackson Laboratory |
Show Experiments (1) |
|
| Animal | Mouse | mTmG mouse (congenic) | mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. | The Jackson Laboratory |
Show Experiments (7)
|
|
| Animal | Mouse | Ai9 mouse (BCM) | Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. | Baylor College of Medicine | ||
| Animal | Mouse | Ai9 mouse | Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. | The Jackson Laboratory |
Show Experiments (11)
|
|
| Animal | Rhesus macaque | Macaca mulatta (Rhesus Macaque) | Tarantal Lab |
Show Experiments (1) |
||
| Animal | Mouse | mTmG mouse | ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence | The Jackson Laboratory | ||
| Animal | Mouse | B6 | C57BL/6J WT mouse | Baylor College of Medicine | ||
| Animal | Mouse | C57BL/6 mouse (Asokan study) | Unspecified | |||
| Animal | Mouse | Ai9-SauSpyCas9 mouse | Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. | Baylor College of Medicine | ||
| Animal | Mouse | TLR-2 mouse | R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways. | The Jackson Laboratory |
Show Experiments (1) |
|
| Animal | Mouse | C57BL/6J mouse | C57BL/6J WT mouse | The Jackson Laboratory |
Show Experiments (3) |
|
| Animal | Mouse | Ai14 mouse (congenic) | Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. | The Jackson Laboratory |
Show Experiments (7)
|
|
| Animal | Mouse | Ai14 mouse | Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. | The Jackson Laboratory |