38 results in Model Systems

Ai14 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

Ai14 mouse (congenic)

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System
Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain.

Ai14 mouse primary fibroblasts

Model System  - [In Vitro] [Mouse]
Matched Fields: category : Model System
Primary fibroblasts from Ai14 mice

Ai9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.
Show Experiments (11)

Ai9 mouse (BCM)

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System
Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus.

Ai9 mouse immortalized fibroblasts

Model System  - [In Vitro] [Mouse]
Matched Fields: category : Model System
Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice

Ai9-SauSpyCas9 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System
Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression.

B6

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System
C57BL/6J WT mouse

BALB/c mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System
BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO).

CD4/CD8 Human Primary T cell

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System
CD4/CD8 Human Primary T cell

HEK-293-TgEF1a-eGFP-BSD

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System
HEK293 cells with lentiviral insertion of EF1a promoter driving expression of eGFP and SV40 promoter driving expression of BSD. HEK293 is an epithelial-like cell that was isolated from the kidney of a patient.

HEK-293T

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System
293T is an epithelial-like cell that was isolated from the kidney of a patient.

HEK-293T with Ai9 transient reporter assay

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System
HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.

HEK-293T-disrupted_GFP with MCV-mcherry-Puro

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System
HEK293T cells with an integrated reporter for TLR-MCV1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.

HEK-293T-disrupted_GFP-mcherry-Puro

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System
HEK293T cells with an integrated reporter for TLR1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.

HeLa

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System
HeLa cells were isolated in 1951 from a cervical carcinoma; Epithelial cell; Uterus; Cervix

Hepa1-6

Model System  - [In Vitro] [Mouse]
Matched Fields: category : Model System
Stable mouse cell line of liver epithelial cells.

Human kidney organoid (ESC-derived)

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System
Kidney organoid derived from human female H9 embryonic stem cells

Human kidney organoid (iPSC-derived)

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System
Kidney organoid derived from human male BJFF iPS cells

K562

Model System  [Human]
Matched Fields: category : Model System

Macaca mulatta (Rhesus Macaque)

Model System  - [In Vivo] [Rhesus macaque]
Matched Fields: category : Model System

Mouse Embryonic Fibroblasts

Model System  - [In Vitro] [Mouse]
Matched Fields: category : Model System
Primary cell line

NK

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System
Natural Killer cells. White blood cells;

Neuro 2A

Model System  - [In Vitro] [Mouse]
Matched Fields: category : Model System
Neuro-2a cells are mouse neuroblasts with neuronal and amoeboid stem cell morphology isolated from brain tissue.

Primary Airway Epithelia (Human)

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System
Primary Airway Epithelia cultured at the air liquid interface

Primary Airway Epithelia (Rhesus Macaque)

Model System  - [In Vitro] [Rhesus macaque]
Matched Fields: category : Model System
Rhesus macaque airway epithelial cells

Primary skin fibroblasts (Rhesus Macaque)

Model System  - [In Vitro] [Rhesus macaque]
Matched Fields: category : Model System
Rhesus macaque primary skin fibroblasts

TLR-2 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System
R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways.

TLR-2 mouse heterozygous blastocyst

Model System  - [In Vitro] [Mouse]
Matched Fields: category : Model System
Blastocyst derived from TLR2 heterozygous mice

TLR-2 mouse homozygous blastocyst

Model System  - [In Vitro] [Mouse]
Matched Fields: category : Model System
Blastocyst derived from TLR2 homozygous mice

TLR-MCV1 mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System
TLR-MCV1 transgene knocked into Rosa26 locus

kidney organoid

Model System  - [In Vitro] [Human]
Matched Fields: category : Model System
kidney organoid derived from human iPS cells

mTmG mouse

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System
ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence

mTmG mouse (congenic)

Model System  - [In Vivo] [Mouse]
Matched Fields: category : Model System
mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed.
Show Experiments (7)

38 results in Model Systems

Type Organism Subtype Name Description Source View Associated...
Animal Mouse Ai14 mouse Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory
Animal Mouse Ai14 mouse (congenic) Ai14 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The att site flanked neo selection cassette has been removed in this strain. The Jackson Laboratory
Cell Mouse Primary cells Ai14 mouse primary fibroblasts Primary fibroblasts from Ai14 mice
Animal Mouse Ai9 mouse Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. The Jackson Laboratory
Show Experiments (11)
Animal Mouse Ai9 mouse (BCM) Ai9 mouse has a loxP-flanked STOP cassette preventing transcription of a CAG promoter-driven red fluorescent protein variant (tdTomato) - all inserted into the Gt(ROSA)26Sor locus. Baylor College of Medicine
Cell Mouse Immortalized Fibroblast (unspecified) Ai9 mouse immortalized fibroblasts Immortalized fibroblasts made from Ai9 (B6.Cg-Gt(ROSA)26Sor^tm9(CAG-tdTomato)Hze/J) mice
Animal Mouse Ai9-SauSpyCas9 mouse Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9) was modified to duplicate the guide target sequences for S. pyogenes and S. aureus Cas9 found on the 3' end of the loxP-flanked stop cassette [SpyCas9 5'GTATGCTATACGAAGTTAT (PAM AGG); SauCas9 5'ACGAAGTTATATTAAGGGTT(PAM CCGGAT)] onto the 5' end of the stop cassette. With this modification, a single guide RNA for S. pyogenes or S. aureus Cas9 can be used to mediate deletion of the stop cassette by non-homologous end joining and activation of tdTomato expression. Baylor College of Medicine
Animal Mouse B6 C57BL/6J WT mouse Baylor College of Medicine
Animal Mouse BALB/c mouse BALB/cJ is a commonly used inbred. Key traits include a susceptibility to developing the demyelinating disease upon infection with Theiler's murine encephalomyelitis virus. The BALB/cJ substrain is susceptible to Listeria, all species of Leishmania, and several species of Trypanosoma, but is resistant to experimental allergic orchitis (EAO). The Jackson Laboratory
Animal Mouse C57BL/6 mouse (Asokan study) Unspecified
Animal Mouse C57BL/6J mouse C57BL/6J WT mouse The Jackson Laboratory
Cell Human Primary cells CD4/CD8 Human Primary T cell CD4/CD8 Human Primary T cell Key Biologicals
Cell Human Immortalized HEK-293-TgEF1a-eGFP-BSD HEK293 cells with lentiviral insertion of EF1a promoter driving expression of eGFP and SV40 promoter driving expression of BSD. HEK293 is an epithelial-like cell that was isolated from the kidney of a patient.
Cell Human Immortalized HEK-293T 293T is an epithelial-like cell that was isolated from the kidney of a patient. ATCC
Cell Human Immortalized HEK-293T with Ai9 transient reporter assay HEK-293T cells transfected with an Ai9 inducible transgene reporter plasmid used to test gene editing activity by fluorescence. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.
Cell Human Immortalized HEK-293T-disrupted_GFP with MCV-mcherry-Puro HEK293T cells with an integrated reporter for TLR-MCV1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.
Cell Human Immortalized HEK-293T-disrupted_GFP-mcherry-Puro HEK293T cells with an integrated reporter for TLR1 reporter editing. HEK293T is an epithelial-like cell that was isolated from the kidney of a patient.
Cell Human HeLa HeLa cells were isolated in 1951 from a cervical carcinoma; Epithelial cell; Uterus; Cervix ATCC
Cell Mouse Hepatoma Hepa1-6 Stable mouse cell line of liver epithelial cells. ATCC
Organoid Human Human kidney organoid (ESC-derived) Kidney organoid derived from human female H9 embryonic stem cells Morizane lab
Organoid Human Human kidney organoid (iPSC-derived) Kidney organoid derived from human male BJFF iPS cells Morizane lab
Organoid Human Human kidney organoid (stem cell-derived) Kidney organoid derived from human female H9 ES or BJFF iPS cells Morizane lab
Cell Human Immortalized K562 ATCC
Animal Rhesus macaque Macaca mulatta (Rhesus Macaque) Tarantal Lab
Cell Mouse Primary cells Mouse Embryonic Fibroblasts Primary cell line In-house: https://jacks-lab.mit.edu/protocols/making_mefs
Cell Human Primary cells NK Natural Killer cells. White blood cells; GreenCross LabCell
Cell Mouse Neuroblastoma Neuro 2A Neuro-2a cells are mouse neuroblasts with neuronal and amoeboid stem cell morphology isolated from brain tissue. ATCC
Cell Human Primary cells Primary Airway Epithelia (Human) Primary Airway Epithelia cultured at the air liquid interface Cystic Fibrosis Foundation or McGill University
Cell Human Primary cells Primary Airway Epithelia (Human) Primary airway epithelia from non-CF donors University of Iowa
Cell Rhesus macaque Primary cells Primary Airway Epithelia (Rhesus Macaque) Rhesus macaque airway epithelial cells Tarantal Lab
Cell Rhesus macaque Primary cells Primary skin fibroblasts (Rhesus Macaque) Rhesus macaque primary skin fibroblasts Tarantal Lab
Animal Mouse TLR-2 mouse R26-GFP_KI-TLR2 ("traffic light reporter") knock-in mice have a CAG promoter controlling expression of Venus (GFP) and TagRFP inserted in the Gt(ROSA)26Sor locus and is a reporter for DNA repair pathways. The Jackson Laboratory
Cell Mouse Primary cells TLR-2 mouse heterozygous blastocyst Blastocyst derived from TLR2 heterozygous mice The Jackson Laboratory
Cell Mouse Primary cells TLR-2 mouse homozygous blastocyst Blastocyst derived from TLR2 homozygous mice The Jackson Laboratory
Animal Mouse TLR-MCV1 mouse TLR-MCV1 transgene knocked into Rosa26 locus
Organoid Human kidney organoid kidney organoid derived from human iPS cells Coriell Institute for Medical Research
Animal Mouse mTmG mouse ROSAmT/mG is a cell membrane-targeted, two-color fluorescent Cre-reporter allele. Prior to Cre recombination, cell membrane-localized tdTomato (mT) fluorescence expression is widespread in cells/tissues. Cre recombinase expressing cells (and future cell lineages derived from these cells) have cell membrane-localized EGFP (mG) fluorescence expression replacing the red fluorescence The Jackson Laboratory
Animal Mouse mTmG mouse (congenic) mTmG is a double-fluorescent reporter transgenic mouse which expresses membrane-targeted tdTomato flanked by loxP sequences, followed by membrane-targeted GFP. After genomic cleavage by Cas9 at two sites, or Cre recombinase between loxP sites, tdTomato expression is lost and GFP is expressed. The Jackson Laboratory
Show Experiments (7)